Resim Cihaz Birim Marka Sorumlu Iletisim Destek Türü
-20°C Derin dondurucu VETERİNER FAKÜLTESİ Prof.Dr. Zafer YAZICI BAP
A4 Fotokopi Kağıdı 80 gr 500 Adet EĞİTİM FAKÜLTESİ Doç.Dr. Ali ERASLAN 3623121919 BAP
A4 Fotokopi Çekim Bedeli EĞİTİM FAKÜLTESİ Doç.Dr. Ali ERASLAN 3623121919 BAP
Baskı Cilt Gideri EĞİTİM FAKÜLTESİ Doç.Dr. Ali ERASLAN 3623121919 BAP
BİLGİSAYAR TIP FAKÜLTESİ Prof.Dr. Ahmet Tevfik SÜNTER 3623121919 BAP
Cerrahi El Motoru Seti TIP FAKÜLTESİ Dr.Öğr.Üyesi Murat Sinan ENGİN 3623121919 BAP
Dijital Baskı Sistemi REKTÖRLÜK Doç.Dr. Onur BEKİROĞLU 3623121919 BAP
Doku Su Banyosu (benmari) (4 L hacimli, oda sıcaklığı ile 100°c arası ayarlanabilir.) Sağlık Hizmetleri Meslek Yüksekokulu Yerli Üretim Teflon Kaplama Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Eletronik terazi (150 kg kapasiteli) ZİRAAT FAKÜLTESİ TEM ( marka) Doç.Dr. Hakan ARSLAN 3623121919 BAP
Flash bellek 16GB EĞİTİM FAKÜLTESİ Doç.Dr. Ali ERASLAN 3623121919 BAP
Gastroskopi-Kolonoskopi Ünitesi (ESD için uygun) ve ESD Malzemeleri TIP FAKÜLTESİ Doç.Dr. Beytullah YILDIRIM 3623121919 BAP
ISSR primer 11 adet ZİRAAT FAKÜLTESİ MACROGEN Prof.Dr. İlknur AYAN 3623121919 BAP
Kızılötesi Termometre HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Lazer Mesafe Ölçer HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Multimetre HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
PCR plate 96' lık 100 adet ZİRAAT FAKÜLTESİ NEW BİOSCİENSE Prof.Dr. İlknur AYAN 3623121919 BAP
PCR plate kapağı 100 adet ZİRAAT FAKÜLTESİ NEW BİOSCİENSE Prof.Dr. İlknur AYAN 3623121919 BAP
REAL TİME PCR CİHAZI KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ BİORAD CFX 96 TOUCH (362)312-1919 BAP
Rotary mikrotom Sağlık Hizmetleri Meslek Yüksekokulu LEİCA RM 2125 RTS Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Rüzgar Ölçer HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Standart markör 100 bp ZİRAAT FAKÜLTESİ NEB Prof.Dr. İlknur AYAN 3623121919 BAP
Sıcaklık ve nem kaydedici cihaz ZİRAAT FAKÜLTESİ Doç.Dr. Hakan ARSLAN 3623121919 BAP
TERMAL ANALİZ SİSTEMİ KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ TA INSTRUMENTS (312)362-1919 BAP
Transpalet HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
UÇUŞ EĞİTİM SİMULATÖRÜ 19 Mayıs Samsun Devlet Konservatuvarı Doç.Dr. Gökhan KAŞTAŞ 3623121919 BAP
X-IŞIN TOZ DİFRAKTOMETRE CİHAZI KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ (362)312-1919 BAP
Öğrenci Bilgisayarı GÜZEL SANATLAR FAKÜLTESİ Doç.Dr. Ali SEYLAN 3623121919 BAP
Atomik Absorbsiyon Spektrometresi (AAS) -1 Alevli AAS UNICAM 929AA Spectrometer, GF-AS 6800 Shimadzu Prof. Dr. Bekir BATI, Prof. Dr. Hasan CESUR BAP
Baca Gazı Ölçüm Cihazı -1 Testo/350-XL Doç.Dr. B.TOPALOĞLU (362)312-1919 BAP
Fotoğraf Ataçmanlı Mikroskop Diş Hekimliği Fakültesi Olympus Diğer
Matkap Tezgahı Mühendislik Fakültesi ÖZTEKSAN Bölüm Teknisyeni 362 312 19 19 Diğer
Kükürt eritme kazanı Mühendislik Fakültesi Ultra İNŞAAT MÜH. BÖL. BŞK. 362 312 19 19 Diğer
Bulanıklık ölçümü Mühendislik Fakültesi JENWAY 6035 – Türbidümetre çevre müh.böl.bşk. 362 312 19 19 Diğer
Hava kirliliği ölçümü Mühendislik Fakültesi Miran Sapph IR VOC – VOC ölçümü YRD.DOÇ.DR. Andaç AKDEMİR 362 312 19 19 Diğer
Infrared Spektrometre (IR) Cihazı Fen Edebiyat Fakültesi Vertex 80V Bruker FTIR Spektrometresi Diğer
Nükleer Manyetik Rezonans (NMR) Cihazı Fen Edebiyat Fakültesi BRUKER AC 200NMR Diğer
Infrared Spektrometre (IR) Cihazı Fen Edebiyat Fakültesi ATI UNICAM Diğer
Karbon-Kükürt Tayin Cihazı Fen Edebiyat Fakültesi Leco SC-144DR Uzm. Kazım CANBOLAT Diğer
Voltametri Cihazı Fen Edebiyat Fakültesi Metrohm 757 VA Computrace Prof. Dr. Necati MENEK nmenek@omu.edu.tr Diğer
Atomik Absorbsiyon Spektrometresi (AAS) Fen Edebiyat Fakültesi Alevli AAS UNICAM 929AA Spectrometer Prof. Dr. Bekir BATI bbati@omu.edu.tr Diğer
Atomik Absorbsiyon Spektrometresi (AAS) Fen Edebiyat Fakültesi GF-AS 6800 Shimadzu Doç. Dr. Hasan CESUR hasanc@omu.edu.tr Diğer
IR Boyama Cihazı Fen Edebiyat Fakültesi Atac Lab-Dye Ht Prof. Dr. Hasan KOCAOKUTGEN hkocaok@omu.edu.tr Diğer
Sürtünme Haslığı Test Cihazı Fen Edebiyat Fakültesi Otex Lab. DS 207 Counter Gemo Prof. Dr. Hasan KOCAOKUTGEN hkocaok@omu.edu.tr Diğer
Tekli Mod Mikrodalga Reaktörü Fen Edebiyat Fakültesi Cem Labmate-Discover Diğer
Ultraviyole (UV) Cihazı Fen Edebiyat Fakültesi GBC CINTRA 20 UV-Vis Diğer
Ultraviyole (UV) Cihazı Fen Edebiyat Fakültesi ATI Unicam Prof. Dr. Yunus BEKDEMİR bekdemir @omu.edu.tr Diğer
HPLC Yüksek Basınçlı Likit Kromatografi Cihazı Fen Edebiyat Fakültesi Shimadzu Doç. Dr. Ş. Fatma AYGÜN faygun@omu.edu.tr Diğer
Ultrasonik Yıkama Banyosu Fen Edebiyat Fakültesi Sonorex Digital 10 P Bandelin Prof. Dr. A. Nur ONAR nonar@omu.edu.tr Diğer
Polarografi Analizörü Fen Edebiyat Fakültesi EG&G Princeton Applied Research Model 384 B Polarographic Analyzer Prof. Dr. Ender BİÇER ebicer@omu.edu.tr Diğer
Civalı 3 Elektrotlu Sistem Fen Edebiyat Fakültesi EG&G PARC Model 303 A SMDE Prof. Dr. Ender BİÇER ebicer@omu.edu.tr Diğer
Gerilim ve Akım Denetleyici Fen Edebiyat Fakültesi EG&G Princeton Applied Research Potentiostat/Galvanostat Model 263 A Prof. Dr. Ender BİÇER ebicer@omu.edu.tr Diğer
X-Ray Difraktometre Cihazı Fen Edebiyat Fakültesi STOE IPDS II Prof. Dr. Orhan BÜYÜKGÜNGÖR orhanb@omu.edu.tr Diğer
HPGe Dedektörlü Spektrometre Sistemi Fen Edebiyat Fakültesi Ortec Prof. Dr. Hasan GÜMÜŞ hgumus@omu.edu.tr Diğer
Elektron Paramanyetik Rezonans (EPR) Spektrometresi Fen Edebiyat Fakültesi E-line Century Series Prof. Dr. Recep TAPRAMAZ recept@omu.edu.tr Diğer
Nem ve Yoğunluk Ölçme ve Kontrol Cihazı Fen Edebiyat Fakültesi La Crosse Technology Prof. Dr. Hasan GÜMÜŞ hgumus@omu.edu.tr Diğer
Yüksek Basınç Otoklavı Fen Edebiyat Fakültesi Berghof BHL-800 Prof. Dr. Recep TAPRAMAZ recept@omu.edu.tr Diğer
Sodyum Iyodür (NaI) Dedektörü Fen Edebiyat Fakültesi Ortec Prof. Dr. Hasan GÜMÜŞ hgumus@omu.edu.tr Diğer
Laser Point Fen Edebiyat Fakültesi Marko 20p Prof. Dr. Recep TAPRAMAZ recept@omu.edu.tr Diğer
Thermocycler(PCR) Diş Hekimliği Fakültesi Ericomp Deltacycler II sistem Yrd.Doç.Dr.Ayla ÖZTÜRK Diğer
Materyal Test Cihazı Diş Hekimliği Fakültesi Lloyd LRX Diğer
Halimetre Diş Hekimliği Fakültesi İnterscan Diğer
Röntgen Çekim Koltuğu Diş Hekimliği Fakültesi Ritter Diğer
pH metre Diş Hekimliği Fakültesi EDT İnstruments Diğer
Sarsma Tablası ve ilgili cihaz ve yazılımlar Mühendislik Fakültesi Hasarsız deprem etkisi testi için. BÖL.ÖĞRTM GÖRV. 362 312 19 19 Diğer
Üç eksenli kesme Mühendislik Fakültesi YOK BÖL. ÖĞRT. GÖRV. 362 312 19 19 Diğer
Direk kesme cihazı Mühendislik Fakültesi RMU testing equipment BÖLÜM ÖĞRT. GÖRV. 362 312 19 19 Diğer
Tek yönlü konsolidasyon cihazı Mühendislik Fakültesi RMU 362 312 19 19 Diğer
Likit limit cihazı Mühendislik Fakültesi BÖL.ÖĞRTM. GÖRV. 362 312 19 19 Diğer
Kür havuzu Mühendislik Fakültesi İNŞAAT MÜH.BÖL. BŞK. 362 312 19 19 Diğer
Eleme Makinası Mühendislik Fakültesi YOK Yrd. Doç.Dr.Münir Anıl 362 312 19 19 Diğer
Otoklav Mühendislik Fakültesi Nüve OT 4060V Yrd. Doç.Dr.Mustafa Evren 362 312 19 19 Diğer
Yakma Cihazı Mühendislik Fakültesi Gerhardt Arş. Gör. Umut AYKUT 362 312 19 19 Diğer
Distilasyon Cihazı Mühendislik Fakültesi Gerhardt Arş. Gör. Umut AYKUT 362 312 19 19 Diğer
Gaz Kromatografisi Mühendislik Fakültesi SHIMADZU GC/MS Doç. Dr. Bahtiyar ÖZTÜRK 362 312 19 19 Diğer
Los Angles cihazı Mühendislik Fakültesi Baz makine, MSB – P208 İNŞAAT MÜH.BÖL.BAŞKANLIĞI 362 312 19 19 Diğer
Beton karma makinası (Pan tipi Mühendislik Fakültesi Pan tipi,Üsten karıştırmalı İNŞAAT MÜH. BÖL. BŞK. 362 312 19 19 Diğer
Basınç Dayanım ve Kiriş kırma Mühendislik Fakültesi ALFA, pres max (Teknodinamik) İNŞAAT MÜH.BÖL.BŞK 362 312 19 19 Diğer
Vibrasyonlu masa Mühendislik Fakültesi İNŞAAT MÜH.BÖL.BŞK 362 312 19 19 Diğer
Kesme Testeresi Mühendislik Fakültesi Koç-Mak, 220-240 V İNŞAAT MÜH. BÖL. BŞK 362 312 19 19 Diğer
Beton Presini Dijitale Çevirme Cihazı Mühendislik Fakültesi Teknodinamik Marka İNŞAAT MÜH.BÖL. BŞK 362 312 19 19 Diğer
Karot makinası Mühendislik Fakültesi Hıltı/DO-160E İNŞAAT MÜH. BÖL. BŞK 362 312 19 19 Diğer
İnkübatör Diş Hekimliği Fakültesi Nüve EN 025 Yrd.Doç.Dr.Eda GÜLER 312 19 19 Diğer
pH iyonometre Diş Hekimliği Fakültesi Thermo Electron Corporation Diğer
Electrosonic Caries Measurement Monitör Diş Hekimliği Fakültesi ECM Lode Diagnostic Diğer
Kesit Alma Cihazı Diş Hekimliği Fakültesi İsomet 1000 Yrd.Doç.Dr Fikret YILMAZ 312 19 19 Diğer
Hassas Aşındırma ve Parlatma Cihazı Diş Hekimliği Fakültesi Buehler Phoenix Beta Yrd.Doç.Dr.Fikret YILMAZ 312 19 19 Diğer
Çelik Deney Yapısı Mühendislik Fakültesi İNŞAAT MÜH. BÖL .BŞK. 362 312 19 19 Diğer
Vinç Sistemi ve Çelik Çerçevesi Mühendislik Fakültesi İNŞAAT MÜH.BÖL.BŞK 362 312 19 19 Diğer
Hava kirliliği ölçümü Mühendislik Fakültesi Environment S.A YRD.DOÇ.DR. Andaç AKDEMİR 362 312 19 19 Diğer
Sıvı Azot Tankı Bom Diş Hekimliği Fakültesi Air Liquide Cryogenie Diğer
Baca Gazı Ölçüm Cihazı Mühendislik Fakültesi Testo/350-XL Doç.Dr. B.TOPALOĞLU Diğer
Besinsel Lif Cihazı Mühendislik Fakültesi Velp Scentifica Yrd. Doç.Dr.Münir Anıl 362 312 19 19 Diğer
Protein Cihazı Mühendislik Fakültesi BUCHI Yrd. Doç.Dr.Hasan TEMİZ 362 312 19 19 Diğer
MOR ÖTESİ UV VISIBL SPEKTROFOTOMETRE Veteriner Fakültesi SHIMADZU UV-1240 ABDURRAHMAN AKSOY aaksoy@omu.edu.tr Diğer
ELEKTROFOREZ CİHAZI Veteriner Fakültesi THERMA EC 1000-90 GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
MİKRO ELİZA OKUYUCU Veteriner Fakültesi PLATE READER GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
ELEKTROFOREZ CİHAZI Veteriner Fakültesi HOEFER SE 260 GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
CRYOSTAT CİHAZI Veteriner Fakültesi LEICA C 1510 M. YAVUZ GÜLBAHAR myg64@omu.edu.tr Diğer
DİSEKSİYON MİKROSKOBU Veteriner Fakültesi OLYMPUS 5261 M. ERDEM GÜLTEKİN erdemg@omu.edu.tr Diğer
GAZ KROMOTOGRAFİ CİHAZI Veteriner Fakültesi SHIMADZU GC-17A ABDURRAHMAN AKSOY aaksoy@omu.edu.tr Diğer
LAMİNER FLOW PCR KABİN Veteriner Fakültesi ESCO AVC4 FTA OKTAY GENÇ ogenc@omu.edu.tr Diğer
UV TRRANSİLİMATÖR Veteriner Fakültesi VİLPER LOUMART ETX 26 OKTAY GENÇ ogenc@omu.edu.tr Diğer
OTOANALİZÖR Veteriner Fakültesi AMS GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
KJELDAL SİSTEMİ Veteriner Fakültesi BUCHİ Ö. HAKAN MUĞLALI hmuglali@omu.edu.tr Diğer
KÜL FIRINI Veteriner Fakültesi PROTHERM PTL 120/7 BELGİN SIRIKEN bsiriken@omu.edu.tr Diğer
Derin Dondurucu Ziraat Fakültesi New Brunswick Scıentific Prof.Dr.Leyla DEMİRSOY Diğer
Termal Siklus Cihazı Diş Hekimliği Fakültesi Dentester Salubris Technica Diğer
Motor Hız Kontrol Cihazı Mühendislik Fakültesi SIEMENS/Micromaster 420 Yrd.Doç.Dr.M.ÖZBEY 362 312 19 19 Diğer
Metal Mikroskobu Mühendislik Fakültesi OLIMPUS Yrd.Doç.Dr. K.YILDIZLI 362 312 19 19 Diğer
Sertlik Ölçme Cihazı Mühendislik Fakültesi BULUT MAKİNA Yrd.Doç.Dr.K.YILDIZLI 362 312 19 19 Diğer
Görüntüleme Cihazı Mühendislik Fakültesi AVE-ENE Yrd.Doç.Dr.İlkay KOCA 362 312 19 19 Diğer
Fanlı Etüv Mühendislik Fakültesi Nüve FN500 Yrd. Doç.Dr.İlkay KOCA 362 312 19 19 Diğer
Rotary Evaporatör Mühendislik Fakültesi BÜCHİ Rotavapor R-200 ve Heating Bath B-490 Yrd.Doç.Dr.İlkay KOCA 362 312 19 19 Diğer
Dondurarak Kurutucu (Liyofilizatör) Mühendislik Fakültesi VirTis Yrd.Doç.Dr.Münir Anıl 362 312 19 19 Diğer
ABBE Refraktometresi Mühendislik Fakültesi Atago Yrd. Doç.Dr.Münir Anıl 362 312 19 19 Diğer
Polarimetre Mühendislik Fakültesi CETE MRK. Arş. Gör. Umut AYKUT 362 312 19 19 Diğer
Gaz Kromotografisi Mühendislik Fakültesi SHIMADZU Yrd. Doç.Dr.Hasan TEMİZ Diğer
TRANSLÜMÜNATÖR Veteriner Fakültesi WISE WUV-M20 GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
LAMİNARFLOV KABİN Veteriner Fakültesi CLANLAF ERTAN EMEK ONUK eeonuk@æomu.edu.tr Diğer
THERMALCYLER Veteriner Fakültesi TECHNE GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
SEMIDRY BLOT CİHAZI Veteriner Fakültesi THERMO SCIENTIFIC OWL HEP-1 GÜL FATMA YARIM gulyarim@omu.edu.tr Diğer
Hassas Terazi Diş Hekimliği Fakültesi Precisa XB 220 A Araş.Gör.Sezin ÖZER 31219 19 Diğer
Varyak Mühendislik Fakültesi VAR SAN Yrd.Doç.Dr.M.ÖZBEY 362 312 19 19 Diğer
Yüksek Basınçlı Sıvı Kromotografisi(HPLC) Mühendislik Fakültesi SHIMADZU Yrd. Doç.Dr.Hasan TEMİZ 362 312 19 19 Diğer
Reometre Mühendislik Fakültesi HAAKE MARS 3 Doç. Dr. Talip KAHYAOĞLU 362 312 19 19 Diğer
Tekstür Analiz Mühendislik Fakültesi TA XT Plus DOÇ.DR. TALİP KAHYAOĞLU 362 312 19 19 Diğer
İZOLE ORGAN BANYOSU SİSTEMİ Veteriner Fakültesi BIOPAC MP 150 USA ABDURRAHMAN AKSOY aaksoy@omu.edu.tr Diğer
LİKİT KROMOTOGRAFİ CİHAZI Veteriner Fakültesi SHIMADZU PROMINENCE ABDURRAHMAN AKSOY aaksoy@omu.edu.tr Diğer
ULTRASONOGRAFİ CİHAZI Veteriner Fakültesi A Loka SSD-500 FİLİZ AKDAĞ filizakdag@omu.edu.tr Diğer
Soğutmalı Santrifüj Diş Hekimliği Fakültesi Hettich Zentrifugen Mikro 200 R Prof.Dr.Gözlem CEYLAN 312 19 19 Diğer
Burulma Test Düzeneği Mühendislik Fakültesi GUNT WP500, Maks Yrd.Doç.Dr. K.YILDIZLI 362 312 19 19 Diğer
Üniversal Test Makinası Mühendislik Fakültesi GUNT WP300, Maks Yrd.Doç.Dr. K.YILDIZLI 362 312 19 19 Diğer
Radyal Kaymalı Yatak deney Seti Mühendislik Fakültesi GUNT TM282 Prof. Dr. Erdem KOÇ 362 312 19 19 Diğer
Yorulma Test Düzeneği Mühendislik Fakültesi GUNT/WP140 Prof. Dr. Erdem KOÇ 362 312 19 19 Diğer
Çekme-Eğme Test Makinası Mühendislik Fakültesi MARES-Tst_10t_me Yrd.Doç.Dr. K.YILDIZLI 362 312 19 19 Diğer
Optik-Elastohidrodinamik Deney Modülü, Mühendislik Fakültesi GUNT/TM260.02 Prof.Dr.Erdem KOÇ 362 312 19 19 Diğer
Rüzgâr Tüneli Mühendislik Fakültesi (SANGARİ) FLOTEK/1440 Yrd.Doç.Dr.M.ÖZBEY 362 312 19 19 Diğer
Viskozitemetre Mühendislik Fakültesi TESTFORM Yrd.Doç.Dr. H.ÖZCAN 362 312 19 19 Diğer
Metal Zımparalama ve Parlatma Cihazı Mühendislik Fakültesi Metkon, FORCIPOL 2V Yrd.Doç.Dr. Başak MESCİ 362 312 19 19 Diğer
Metalografik Numune Kesme Cihazı Mühendislik Fakültesi Metkon, METACUT M-250 Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Metalografik Numune Kalıplama Presi Mühendislik Fakültesi Metkon, METAPRESS-A Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Laboratuar Tipi Elek Makinesi, Mühendislik Fakültesi Fritsch, Analysette 3, Zaman ve titreşim şiddeti fonksiyonlu, Dijital göstergeli Yrd.Doç.Dr. Başak MESCİ 362 312 19 19 Diğer
Halkalı Titreşimli Öğütücü Mühendislik Fakültesi ÜNAL MRK. Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Bilyalı Değirmen (öğütücü), Mühendislik Fakültesi Ceramic Instruments Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Geçirgenlik Test Cihazı Mühendislik Fakültesi Fore Beton Test Cihazı Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Isıl iletkenlik Tayin Cihazı Mühendislik Fakültesi : Fore, FR-B097 Yrd.Doç.Dr.Başak MESCİ 362 312 19 19 Diğer
Dijital penatrasyon cihazı Mühendislik Fakültesi Baz Makine, Linear Dijital Cetvel Prof. Dr. Mehmet ÇAKIROĞLU 362 312 19 19 Diğer
Ultrasonik dijital test çekici Mühendislik Fakültesi Matest, C372N Yrd. Doç. Dr. Kemal Hacıefendioğlu 362 312 19 19 Diğer
Spray Kurutucu Mühendislik Fakültesi BUCHI Mini Spray Dryer B-290 Doç.Dr. Talip KAHYAOĞLU 362 312 19 19 Diğer
Taşınabilir Gaz Kromatografi Diş Hekimliği Fakültesi Abilit Oral Chroma Yrd.Doç.Dr.İnci DEVRİM 312 19 19 Diğer
Hassas Sürtünme Ölçüm Aparatı Mühendislik Fakültesi GUNT TM210 Prof.Dr.Erdem KOÇ 362 312 19 19 Diğer
Motor Hız ve Tork Ölçüm Cihazı (Dişli verimliliği belirleme Mühendislik Fakültesi GUNT AT100+AT200 Prof.Dr. Erdem KOÇ 362 312 19 19 Diğer
MICROTOM Veteriner Fakültesi ROTARY MICROTOM RM 2235 ŞERİFE TÜTÜNCÜ serifetutuncu@omu.edu.tr Diğer
DİZÜSTÜ BİLGİSAYAR EĞİTİM FAKÜLTESİ Prof.Dr. Zeki KARAKAYA (362)312-1919 BAP
NGF beta 20µg DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nilüfer ÖZKAN (362)312-1919 BAP
Trinoküler Araştırma Mikroskobu ZİRAAT FAKÜLTESİ Prof.Dr. Orhan KURT (362)312-1919 BAP
Havadan Görüntüleme Helikopteri ve Teçhizatı MÜHENDİSLİK FAKÜLTESİ İNSANSIZ HAVA RACI Dr.Öğr.Üyesi Gökhan KAYHAN (362)312-1919 BAP
Derin dondurucu (Dikey tip, 7 çekmeceli, sabit sıcaklık) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Levent MERCAN (362)312-1919 BAP
Termos (en az 9 lt iç kapasite, taşıma kollu, muhafaza ömrü en az 12 saat, 4 adet buz kaseti ile birlikte) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Levent MERCAN (362)312-1919 BAP
EPSON PERFECTION V700 PHOTO TARAYICI + WhinRhizo Pro kök görüntü analiz programı (yazılım) ZİRAAT FAKÜLTESİ Doç.Dr. Erkut PEKŞEN (542)676-7494 BAP
Yüksek Performanslı Katı Meyve Sıkacağı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Muhammet DERVİŞOĞLU (362)312-1919 BAP
Fotoğraf makinesi EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Yücel ÖKSÜZ (362)312-1919 BAP
Tablet PC EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Yücel ÖKSÜZ (362)312-1919 BAP
projeksiyon EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Yücel ÖKSÜZ (362)312-1919 BAP
Genis açılı fotoğraf makinesi ve seti (ek teçhizatları) EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Dijital Kumpas ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Ismail SEZER (362)312-1919 BAP
Etüv ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Hasan Murat AKSOY (312)191-9134 BAP
Kar Buz Yapma Makinası ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Hasan Murat AKSOY (312)191-9134 BAP
Otoklav ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Hasan Murat AKSOY (312)191-9134 BAP
Bilgisayar ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Akif ÇAM (362)312-1919 BAP
Refraktometre ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Ismail SEZER (362)312-1919 BAP
Kesintisiz Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ İNFORM Dr.Öğr.Üyesi Gökhan KAYHAN (362)312-1919 BAP
Tarayıcı MÜHENDİSLİK FAKÜLTESİ HP Dr.Öğr.Üyesi Gökhan KAYHAN (362)312-1919 BAP
taşınabilir harici disk 1 TB MÜHENDİSLİK FAKÜLTESİ WESTERN Dr.Öğr.Üyesi Gökhan KAYHAN (362)312-1919 BAP
Animal Treadmill (4 Kanallı) TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ (362)312-1919 BAP
Etüv (Sterilizatör) Fırın FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
NIRS için Çeltik Kalibrasyon Seti ZİRAAT FAKÜLTESİ FOSS IC-1044FE Dr.Öğr.Üyesi Ismail SEZER (362)312-1919 BAP
Otoklav FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
Santrifüj FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
Dik tip derin dondurucu TIP FAKÜLTESİ Prof.Dr. Murat GÜNAYDIN (362)312-1919 BAP
Laktat Analizörü 75?lik Strip YÜKSEK OKULLAR Dr.Öğr.Üyesi Tülin ATAN (362)312-1919 BAP
Laktat Analizörü, Laktat Plus YÜKSEK OKULLAR Dr.Öğr.Üyesi Tülin ATAN (362)312-1919 BAP
Numune dağıtıcı cihazı TIP FAKÜLTESİ Prof.Dr. Murat GÜNAYDIN (362)312-1919 BAP
Polar Saat RS 800 YÜKSEK OKULLAR Dr.Öğr.Üyesi Tülin ATAN (362)312-1919 BAP
Notebook FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Muhammet BAHADIR (362)312-1919 BAP
Trinoküler stereo mikroskop ZİRAAT FAKÜLTESİ OLYMPUS Prof.Dr. Ahmet GÜLER (362)312-1919 BAP
Orbital shaker VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Özlem BÜYÜKTANIR (362)312-1919 BAP
Hassas terazi(0.0001g duyarlılık) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine COŞKUN 3121919-5048 BAP
ETÜV ZİRAAT FAKÜLTESİ Prof.Dr. Ali GÜLÜMSER (362)312-1919 BAP
Calpuff View Yazılımı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR (362)312-1919 BAP
Notebook EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Güner TURAL (362)312-1919 BAP
Buzdolabı ZİRAAT FAKÜLTESİ Prof.Dr. Sezgin UZUN (362)312-1919 BAP
3 Çekmeceli Dikey Derin Dondurucu FEN EDEBİYAT FAKÜLTESİ Dr. Melike Çebi KILIÇOĞLU (362)312-1919 BAP
Proxxon 28515 Mikromat 50/E Freze Matkap Set TIP FAKÜLTESİ Prof.Dr. Cafer MARANGOZ (362)312-1919 BAP
Dijital kumpas (Bilgisayara veri aktarabilen) ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
Hassas terazi (0.1 g duyarlılık) ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
Refraktometre (el tipi) ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
Fotoğraf Makinesi FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Muhammet BAHADIR (362)312-1919 BAP
GPS ZİRAAT FAKÜLTESİ Doç.Dr. Orhan DENGİZ (362)312-1919 BAP
GPS Cihazı ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa SAĞLAM (362)312-1919 BAP
MCGRATH MAC macintosh video laringoskop cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ Uzman Aysun Çağlar TORUN (362)312-1919 BAP
Dijital Fotogrametri Yazılımı (Yazılım, Yazılıma uygun Fotogrametrik Fotoğraf Makinesi) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Erdem Emin MARAŞ (362)312-1919 BAP
DİJİTAL GÖRÜNTÜLEME SİSTEMLİ STEREO ZOOM ARAŞTIRMA MİKROSKOBU ZİRAAT FAKÜLTESİ Prof.Dr. Celal TUNCER (362)312-1919 BAP
Ortodontik model tarama cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi Abdullah Alper ÖZ (362)312-1919 BAP
Siemens Acuson X300 PE Ultrasonografi Cihazı TIP FAKÜLTESİ Dr.Öğr.Üyesi Hizir Ufuk AKDEMİR (362)312-1919 BAP
Tarım Traktörü, 75 BG ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
Elektron Spin Rezonans Deney seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
En az 32 kanallı EEG/PSG kombinasyonunu sunabilir Polisomnografi sistemi (2 adet) TIP FAKÜLTESİ Prof.Dr. Nurhan KÖKSAL (362)312-1919 BAP
Balmer Serisi ve Rydberg sabitinin belirlenmesi deney seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
E/m Elektron Yükü Tayini Deney Seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
Hall etkisi deney seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
Heisenberg Belirsizlik ilkesi deney seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
Thomson Tüpü Elektronların Sapması Deney Seti FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Mustafa Çağatay TUFAN (362)312-1919 BAP
limdep ekonometrik yazılım ZİRAAT FAKÜLTESİ Prof.Dr. Vedat CEYHAN (362)312-1919 BAP
Mikrodalga Sindirim Sistemi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Hanife BÜYÜKGÜNGÖR (036)231-2191 BAP
AMOS paket programı FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayşenur BÜYÜKGÖZE-KAVAS (362)312-1919 BAP
Kamera EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Dilek ÇELİKLER (362)312-1919 BAP
Desktop YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
1,1,3,3-TETRAETHOXYPROPAN(MDA9 STANDARTI 100 ML DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
3-TRIETHOXYSILY)PROPYLAMIN 100 ML SIGMA 281778 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
Arctigenin-(-) 25 mg DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
Arctiin-(-) 25 mg DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
Digital Burette ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
HPL KOLONU C18 COLUMN(3,9X150MMX0,45 µM) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
HPLC KOLONU C18 150 MMX4,6MM X 5 µ DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
IMMUN KALEM DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
MMP1/8 SC-30069 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
OPG SC-8468 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
PODOLPHYLOTOXIN 100 MG SIGMA P4405 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
RANK SC-9070 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
SU BAZLI IMMUN YAPIŞTIRICI 25 ML DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
TIMP-2 ANTIBODY SC-271932 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
Cerrahi Alet Taşıma Kutusu TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
15N.m Servo Motor ve Surucusu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Kemal YILDIZLI (036)312-1919 BAP
Harddisk FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Muhammet BAHADIR (362)312-1919 BAP
Ankastre fırın YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS 03624576089 BAP
BeBis bilgisayar programı YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Bulaşık makinesi YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Buzdolabı YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Desktop YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Dijital mutfak terazisi YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Mikrodalga fırın YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Mutfak robotu YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Probe termometre YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS (036)245-7608 BAP
Set üstü ocak YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Termal Kamera MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Okan ÖZGÖNENEL (362)312-1919 BAP
Yazıcı YÜKSEK OKULLAR Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Human Orexin A, OX-A ELISA Kit CUSABIO TIP FAKÜLTESİ Doç.Dr. Ömer Faruk AYDIN (362)312-1919 BAP
Human Orexin B, OX-B ELISA Kit CUSABIO TIP FAKÜLTESİ Doç.Dr. Ömer Faruk AYDIN (362)312-1919 BAP
Kafes rafı TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
-20° Derin dondurucu TIP FAKÜLTESİ Doç.Dr. Sezgin GÜNEŞ (362)312-1919 BAP
LİYOFİLİZATÖR FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
su banyosu ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
Dijital Fotoğraf Makinesi (Nikon D5200 18-105 VR Kit 24.1 MP 3) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Ahmet MUTLU (362)312-1919 BAP
DİZÜSTÜ BİLGİSAYAR (Ultrabook-Casper Nirvana Ultrabook CBA.3317-4500V) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Ahmet MUTLU (362)312-1919 BAP
Renkli Lazer Yazıcı (HP Laser Jet Pro 400 Color M451DNW) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Ahmet MUTLU (362)312-1919 BAP
Tablet PC (Casper Vıa Tablet CTA-E10-16A-3G) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Ahmet MUTLU (362)312-1919 BAP
Yansı Kumandası (Logitech R400) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Ahmet MUTLU (362)312-1919 BAP
Tarayıcı FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Muhammet BAHADIR (362)312-1919 BAP
Mini-Protean Tetra Cell Elektroforez Sistemi (Güç kaynağı içinde) ZİRAAT FAKÜLTESİ Doç.Dr. Deniz EKİNCİ (362)312-1919 BAP
Isıtıcılı Manyetik Karıştırıcı ve Kontak Termometre ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
Mikrodalga fırını ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
terazi ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
33x33 cm Zemin sırlı seramik yer döşeme (60m2) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
470x150x90 cm Evyeli seramik orta tezgah FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
470x150x90 cm Evyeli seramik orta tezgah + Tezgaha monte göz duşu FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
540x75x90 cm Seramik kenar tezgahı FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
Dörtlü grup floresan (6 adet) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
Kenar tezgah üstü seramik 540X60 cm FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
Tezgahlar elektrik ve su tesisatı FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
Çalışma tabüresi FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Kamil IŞIK (362)312-1919 BAP
Bebek tartısı 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Bebek ölçüm matı 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Digital tartı 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Mezura(2m) 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Replika Eğitim paketi 49 ?lu 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Apple İmac 3.4 GHz Quad-Core İntel Core i7 Bilgisayar EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Çalkalamalı inkübatör ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
Mikropipet (0,5-10 mikrolitre) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Levent MERCAN (362)312-1919 BAP
Mikropipet (10-100 mikrolitre) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Levent MERCAN (362)312-1919 BAP
Alet ve ilaç taşıma çantası VETERİNER FAKÜLTESİ Prof.Dr. Murat FINDIK (362)312-1919 BAP
Katater (metal serviks kateteri, 6 mm çap) VETERİNER FAKÜLTESİ Prof.Dr. Murat FINDIK (362)312-1919 BAP
Polanski vaginal spekulum (35 cm, inek) VETERİNER FAKÜLTESİ Prof.Dr. Murat FINDIK (362)312-1919 BAP
Uterus Biyopsi Katateri VETERİNER FAKÜLTESİ Prof.Dr. Murat FINDIK (362)312-1919 BAP
Dslr Fotoğraf Makinası Taşıma Çantası EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Fatoğraf Makinasına Uyumlu Orjinal Yedek Batarya EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Fotoğraf Makinasına Uyumlu Flaş EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Fotoğraf Makinasına Uyumlu Hafıza Kartı EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Fotoğraf Makinasına Uyumlu Orjinal Battery Grip EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Hd Video Çekebilen Full Frame Fotoğraf Makinası Body EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Kamera EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Elif Omca ÇOBANOĞLU (362)312-1919 BAP
Pozometre-Flaşmetre EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Talep Edilen Dslr Makinaya Uyumlu 17-40mm F/4 L Usm Lens+ Lens?e Uyumlu Uv Filtre EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Talep Edilen Dslr Makinaya Uyumlu 24-70mm F/2.8l Iı Usm Lens + Lens?e Uyumlu Uv Filtre EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Talep Edilen Dslr Makinaya Uyumlu 50mm F/1.4 Usm Lens + Lens?e Uyumlu Uv Filtre EĞİTİM FAKÜLTESİ Prof.Dr. Zekeriyya ULUDAĞ (362)312-1919 BAP
Lazer uzaklık ölçer REKTÖRLÜK Dr.Öğr.Üyesi Kiraz Erciyas YAVUZ (362)312-1919 BAP
Liç Reaktörü MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ (362)312-1919 (Dah:1343) BAP
Ekzost fanı ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Mini kontrol cihazı ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Sıcaklık nem sensörü ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
pH-EC sıcaklık ölçer ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Hassas Terazi (Dört basamaklı) ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN (362)312-1919 BAP
Canlı Hücre Görüntüleme Ve Hücre Analiz Sistemi VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Dilek GÜVENÇ (362)312-1919 BAP
Dslr Fotoğraf Makinası Için Profesyonel Tripot+ Tripot Kafası+Tripod Çantası İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Dslr Fotoğraf Makinası Taşıma Çantası İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Dslr Fotoğraf Makinası Uyumlu Omuz Aparat Seti İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Dslr Fotoğraf Makinasına Uyumlu 7? Hdslr Monitor /Ips Panel İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Ef 50mm F/2.5 Macro Lens + Lens?e Uyumlu Uv Filtre İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Fotoğraf Makinası Için Lp-E6 Yedek Batarya İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Fotoğraf Makinasına Uyumlu Hafıza Kartı İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Fotoğraf Makinasına Uyumlu Orjinal Battery Grip İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Hd Video Çekebilen Full Frame Fotoğraf Makinası Body İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Isıtıcılı karıştırıcı ZİRAAT FAKÜLTESİ Doç.Dr. Deniz EKİNCİ (362)312-1919 BAP
Monitöre Uyumlu Battery Seti İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
pH metre (Masa Tipi) ZİRAAT FAKÜLTESİ Doç.Dr. Deniz EKİNCİ (362)312-1919 BAP
250 GB 3.5" simple swap SATA disk MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Birim Ağırlık Kovaları MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Metal tepsi (300mm çaplı, derinliği 40mm) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Mezur Cam Seti (20-50-100-250-500-1000-2000 ml) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Porselen Pota (150 mm çaplı) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Sanallaştırma sunucusu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Sodyum heksametafosfat MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Spektrofotometre ZİRAAT FAKÜLTESİ Doç.Dr. Deniz EKİNCİ (362)312-1919 BAP
Sıkıştırma ve kalıp tokmakları MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Temizleme Fırçası (ince elek için) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Temizleme Fırçası (kalın elek için) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Tepsi (metal veya plastikten, su geçirmez, kenar uzunluğu 450-900mm,derinliği 75-150mm, kare olacak şekilde) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Çeşitli kablar MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
İnce İstemci sunucusu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
AERMOD VIEW HAVA KALİTE DAĞILIM MODELİ MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR (362)312-1919 BAP
Büzülme Cihazı (Rötre Ölçüm Cihazı) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
CALROAD HAVA KALITE DAĞILIM MODELİ MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR (362)312-1919 BAP
Dijital Nivo Seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Donatı Yeri Tayin Cihazı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Hidrometre deney seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Lazer Mesafe ölçer 250 m MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Plastik Limit deney seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Plotter Yazıcı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Sıkıştırma faktörü cihaz seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Blood (10 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Cartilage And Bones (11 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Connective Tissues(10 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Epithelial Tissues (10 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Muscle Tissues (6 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Nerve Tissues (10 Lamlık Paket) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
1-(4-Aminophenyl)-piperazine FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
2,3-Dibromo-1,4-butanediol FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
2,4-Difluorobenzylamine FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
2,5-DİFLOROBENZYLAMİNE SİGMA 264385 5 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
2,6-DİCHLOROANİİLİNE SİGMA D55504 25 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
2-AMİNO-5-PHENYL-(1,3,4)-THİADİAZOLE SİGMA 438537 1 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
3-CHLORO-4-(4-CHLORO-PHENOXY)ANİLİNE SİGMA 561247 1 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
3-METHOXY-5-(TRİFLUOROMETHYL)ANİLİNE SİGMA 196932 5 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
4-AMİNOBENZENETHİOL SİGMA 422967 5 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
4-AMİNOBENZOTRİFLUORİDE SİGMA 224936 10 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
4-Aminothiophenol FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
4-BROMO-2-(TRİFLUOROMETHOXY)ANİLİNE SİGMA 297704 5 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
4-METHYLANİLİNE SİGMA 236314 25 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
5-Aminoisophtalicacid FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
BENZOYL HİDRAZİNE SİGMA B13071 25 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Benziylmonohidrazin FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
CARBAMYLCHOLİNE CHOLRİDE SİGMA C4382 10 gr FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
DMF FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Etilalkol (merck) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Etilalkol (yerli) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Hydrochinon FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
N,N-dimetiletanolamin FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
N-(2-HYDROXYETHYL)ACETAMİDE SİGMA 100455 25 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
N-PHENYL-P--PHENYLENEDİAMİNE SİGMA 241393 FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
N-hekzan FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
O-DİANSİDİNE SİGMA D9143 5 GR FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Oxylklorür FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
Tetrahidrofuran FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Erbil AĞAR (036)231-2191 BAP
mini traktör ZİRAAT FAKÜLTESİ Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Oküler elektrofizyoloji (Sweep VEP) cihazı TIP FAKÜLTESİ Doç.Dr. İnci GÜNGÖR (362)312-1919 BAP
Class II Laminar Kabin VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Dilek GÜVENÇ (362)312-1919 BAP
Karbondioksitli İnkubatör VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Dilek GÜVENÇ (362)312-1919 BAP
Safsau cihazı ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
Otoklav MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI (362)312-1919 BAP
Sıcaklık Modülü MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Talip KAHYAOĞLU (362)312-1919 BAP
Portatif pH,İletkenlik,Sicaklik Ölçer (Problu) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
Beton Kiriş Numune Kalıbı - Laboratuar Tipi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Beton basınç test presi (kiriş aparatı + bilgisayar ile birlikte + yazıcı) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Casagrande Aleti ve Deney Seti (Likit Limit) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
El Tipi Dalgıç Beton Vibratör MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Elek Analizi Seti (ASTM D6913-04) aşağıdakiler; (göz açıklığı) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Elek Sarsma Mekanizması MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Kompresör MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Konsolidasyon test cihazı, ön yüklemeli ödometre seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
L kutusu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Laboratuvar mikseri MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Lazer Mesafe ölçer 60 m MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Numune çıkarma krikosu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Optik Nivo MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
U kutusu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
V hunisi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Padscan HD 5 ultrason TIP FAKÜLTESİ Doç.Dr. Ünal BIÇAKCI (362)312-1919 BAP
Spektrofotometre MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Talip KAHYAOĞLU (362)312-1919 BAP
Anatomik ve Fizyolojik Kartlar MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Naci MURAT (312)191-9100 BAP
Kronometre MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Naci MURAT (312)191-9100 BAP
Mesleki Yetenekler Değerlendirme Seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Naci MURAT (312)191-9100 BAP
Otur Eriş Sehpası MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Naci MURAT (312)191-9100 BAP
Titreşim Ölçüm Cihazı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Naci MURAT (312)191-9100 BAP
Mikroskop ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
4x3x1,5mt. + 2 Lift Stüdyo Tavan Ray Sistemi İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Öğrenci bilgisayarları GÜZEL SANATLAR FAKÜLTESİ Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Bilgisayar Desktop ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Akif ÇAM (362)312-1919/1364 BAP
Çeker Ocak TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Kimyasal malzemeleri saklamak için çelik dolap(92X42X195) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
Kamera EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Çeker ocak ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN (362)312-1919 BAP
100 X 200 Cm Ürün Çekim Masası İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
120x120x120 Cubelite Ürün Çekim Çadırı 4 Renk Fonlarıyla Beraber İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
150x200 Cm. 5?li Reflektör Seti İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
2,75x11 M 3 Renk (Siyah , Beyaz, Yeşil) Kağıt Fon İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Autopole Sistemine Uygun Fon Kanca Sistemi İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Autopole Sistemine Uygun Fon Tutucu Metal Zincir Sistemi İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Profesyonel Stüdyo Autopole İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Profesyonel Stüdyo Flaşı İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Stüdyo Flaş Sistemine Uyumlu 83 Cm Reflektif Gümüş Şemsiye İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Stüdyo Flaş Sistemine Uyumlu Orijinal Snoot İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Hububat Anıza Ekim Makinası ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
Döngüsel Yorgunluk Test Cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Uğur İNAN (362)312-1919 BAP
Gaz Ozon Ölçüm Cihazı MÜHENDİSLİK FAKÜLTESİ ECO OS6 ABD Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
Klima ZİRAAT FAKÜLTESİ Doç.Dr. Hasan Murat AKSOY (312)191-9134 BAP
Laminar Flow Steril Kabin ZİRAAT FAKÜLTESİ JSR MARKA JSCB-1200 MODEL GÜNEY KORE Dr.Öğr.Üyesi Musa KAVAS (362)312-1919 BAP
Clipped Corner X-tra® Adhesive Slides DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. N. Umur SAKALLIOĞLU (362)312-1919 BAP
60" Full HD TV GÜZEL SANATLAR FAKÜLTESİ Vestel 65PF7575 165cm Uydulu Smart LED TV Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Güç Kaynağı GÜZEL SANATLAR FAKÜLTESİ NECRON DT SERİSİ DT 10KVA Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Yönetici bilgisayarı (5 yıl uzatılmış garanti) GÜZEL SANATLAR FAKÜLTESİ APPLE ME253TU/A Mac Pro 3.7GHz 4-Quad-Core Intel Xeon E5 27" Thunderbolt Ekran Kablosuz Klavye Mouse Set Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Ultrasonik su banyosu VETERİNER FAKÜLTESİ ISOLAB Doç.Dr. Alper ÇİFTCİ (362)312-1919 BAP
Dikey Tip Otoklav VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Dilek GÜVENÇ (362)312-1919 BAP
Fluoresan Ataçmanlı Trinokuler İnverted Mikroskop ve Görüntüleme sistemi VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Dilek GÜVENÇ (362)312-1919 BAP
BİPAP cihazı TIP FAKÜLTESİ Prof.Dr. Nurhan KÖKSAL (362)312-1919 BAP
Toprak Frezesi ADALET MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ömer ÇALIŞKAN (362)542-6762 BAP
el çapa makinası ADALET MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ömer ÇALIŞKAN (362)542-6762 BAP
DİZÜSTÜ BİLGİSAYAR EĞİTİM FAKÜLTESİ LENOVA 20CD0038TX i7-4500U YOGA 12.5" Dr.Öğr.Üyesi Bayram ÖZER (362)312-1919 BAP
Çok fonksiyonlu yazıcı (1 adet) EĞİTİM FAKÜLTESİ BROTHER 9/40 MODEL Dr.Öğr.Üyesi Bayram ÖZER (362)312-1919 BAP
Buzdolabı 430-540 lt kapasiteye sahip( no-frost) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
Hotpack Kazanı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Portatif TENS Cihazı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Skinfold HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Stimülatör Cihazı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
İnfraruj Cihazı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
lazer yazıcı ve tarayıcı FEN EDEBİYAT FAKÜLTESİ XEROX5022V-U WORK CENTRE5021D Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Kombine Elektroterapi-Vakum ve Ultrason Cihazı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Parafin Cihazı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
DNA Elektroforez-(orta boy) seti TIP FAKÜLTESİ CBS MGU-602 T , 300X GÜÇ KAYNAĞI Prof.Dr. Hasan BAĞCI (362)312-1919 BAP
Atomizör ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN (362)312-1919 BAP
External Ses Kartı EĞİTİM FAKÜLTESİ creative SB x-fi surround 5.1.pro usb ses kartı Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Flüt EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Hassas Terazi ve Arşimed Yoğunluk Kitli Ölçüm Seti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Klasik Gitar EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Mikrofon EĞİTİM FAKÜLTESİ shure sm58-lce dinamik vokal mik. Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Taşınabilir Bilgisayar EĞİTİM FAKÜLTESİ dell 3542 8 gb. 15.6'' win 8.1 Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Ultrasonik su banyosu MÜHENDİSLİK FAKÜLTESİ VWR USC 300 THD Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Alet Çantası, Mannesman MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Darbeli Matkap, Bosch GSB 16 RE MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Demir Saplı Çekiç, 1kg MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Matkap Ucu Seti, Maestro MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
ÇALKALAMALI İNKÜBATÖR MÜHENDİSLİK FAKÜLTESİ MİKROTEST Prof.Dr. Fehmi YAZICI (362)312-1919 BAP
Örslü mengene MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
ofis histeroskopi seti TIP FAKÜLTESİ RICHARD WOLF 2014 MODEL Dr.Öğr.Üyesi Emel KURTOĞLU (362)312-1919 BAP
100 ml beher FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
100 ml dereceli silindir FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
150 ml beher FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
2,2?-Thiodiacetic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
2-Nitrobenzoic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
3,3?-Thiodipropionic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
3,4-Dimethoxybenzoic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
3-Methoxybenzoic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
4-Hydroxy-3-nitrobenzoic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
50 ml beher FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
50 ml dereceli silindir FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
50 ml pipet FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Acetone FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Benzilic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Benzylethylamine FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Cobalt(II) chloride hexahydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Cobalt(II) nitrate hexahydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Ethanol FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Ethylenediamine FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Glutaric acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Glycolic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Iminodiacetic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Isonicotinamide FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Malonic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Mandelic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Manganese (II) sulfate monohydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Manganese(II) nitrat tetrahydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Methanol FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Mikrosantrfüj tüpleri 1,5 ml 500 lük FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Mikrosantrfüj tüpleri 2 ml 500 lük FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
N,N?-Bis(salicylidene) ethylenediamine FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Nickel (II) sulfate hexahydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Nicotinamide FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Orotic acid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Triethylamine FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
Zinc nitrate hexahydrate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
kaba filtre kağıdı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
manyetik balık (30x6 mm) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
manyetik balık (40x8 mm) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
p-Phenylenediamine FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
plastik şişe 100 ml FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
plastik şişe 50 ml FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Muharrem DİNÇER (362)312-1919/5260 ve5060 BAP
100x90 4 Kapaklı Evrak Dolabı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
160x70 Öğretim elemanı Masası MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
160x70 Üç Boyutlu Yazıcı Masası MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
3 D Printer MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
75x90x55 Bilgisayar Masası MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Akıllı Tahta MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Büro Koltuğu MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Inverter Split Klima MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Kabin MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Kenar Anahtar(Switch) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Kesintisiz Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Yükseltilmiş Döşeme Sistemi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Isıtıcılı manyetik karıştırıcı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
TG/DTA DETEKTÖR MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
Elektrikli şamandra MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nurdan Gamze TURAN (362)3121919/1329 BAP
Termometre (0-100°C, civalı) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nurdan Gamze TURAN (362)3121919/1329 BAP
Cusabio CSB-E15005h Human SCUBE1 elisa kit TIP FAKÜLTESİ Doç.Dr. Burçin ÇELİK (362)312-1919 BAP
BİLGİSAYAR MÜHENDİSLİK FAKÜLTESİ oem Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Ozon Jenaratörü MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
DİZÜSTÜ BİLGİSAYAR EĞİTİM FAKÜLTESİ acer aspire e1572g. Prof.Dr. Hanife Nalan GENÇ (362)312-1919 BAP
Masa üstü bilgisayar EĞİTİM FAKÜLTESİ pro 2000 busines b serisi Prof.Dr. Hanife Nalan GENÇ (362)312-1919 BAP
No-Frost Buzdolabı ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
Televizyon SMART EĞİTİM FAKÜLTESİ philips 47'' pfk6309 Prof.Dr. Hanife Nalan GENÇ (362)312-1919 BAP
Çok fonksiyonlu yazıcı EĞİTİM FAKÜLTESİ brother mfc-1811 Prof.Dr. Hanife Nalan GENÇ (362)312-1919 BAP
Bilgisayar ZİRAAT FAKÜLTESİ Prof.Dr. Sevilhan MENNAN (362)312-1919 BAP
Diyapozon (Ses Çatalı) EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Hava Boşaltım Tulumbası EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Hava Boşaltım Tulumbası İçin Fanus EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Mualla BOLAT (362)312-1919 BAP
Çeker ocak ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan Kurt KIZILDOĞAN (362)312-1919 BAP
A 4 Tarayıcı GÜZEL SANATLAR FAKÜLTESİ HP 300 Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Apple Airport Time Capsule GÜZEL SANATLAR FAKÜLTESİ APPLE ME 177TU/A AIRPORT TIME CAPSULE 2TB Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Apple Remote (Uzaktan Kumanda) GÜZEL SANATLAR FAKÜLTESİ Doç.Dr. Ali SEYLAN (362)445-0118 BAP
HDMI -Mini DVI Adaptörü (MAC için) GÜZEL SANATLAR FAKÜLTESİ S-INK MD75 Doç.Dr. Ali SEYLAN (362)445-0118 BAP
HDMI Kablo (5 m.) GÜZEL SANATLAR FAKÜLTESİ S-LINKSL-H055 5 M HDMI kablo altın uçlu v1.4 3d Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Manyetik Karıştırıcı VETERİNER FAKÜLTESİ IKA C MAG HS7 Doç.Dr. Göknur TERZİ GÜLEL (362)312-1919 BAP
SLR Dijital Fotoğraf Makinesi GÜZEL SANATLAR FAKÜLTESİ NİCON 3100 18-55/55-200 LENS İLE Doç.Dr. Ali SEYLAN (362)445-0118 BAP
Akıllı Tahta EĞİTİM FAKÜLTESİ Prof.Dr. Hanife Nalan GENÇ (362)312-1919 BAP
Frezeli Ara Çapa Makinası ZİRAAT FAKÜLTESİ YÜKSAN TARIM MAK Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
Gübre Dağıtma Makinası ZİRAAT FAKÜLTESİ EGE SEBAT TARIM MAK Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
Toprak Frezesi ZİRAAT FAKÜLTESİ YÜKSAN TARIM MAK Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
MANUEL PRES MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Elektrik Tahrikli Motor ve Transmisyon Sistemi Eğitim Ünitesi ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Arif BEYHAN (362)312-1919 BAP
Dijital Kumpas DİŞ HEKİMLİĞİ FAKÜLTESİ BTS 150 MM Doç.Dr. Emel BULUT (362)312-1919 BAP
Steril Esnek Cerrahi Cetvel DİŞ HEKİMLİĞİ FAKÜLTESİ MEDBAR Doç.Dr. Emel BULUT (362)312-1919 BAP
tohum dolabı ADALET MESLEK YÜKSEK OKULU Doç.Dr. Ömer ÇALIŞKAN (362)542-6762 BAP
PLASTİK VE KAUÇUK MALZEME AŞINMA CİHAZI MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
SHORE A DİJİTAL SERTLİK CİHAZI-DESTEK STANDI-EL ÇANTASI KOMPLE , GIBITRE MARKA Manual Digital Hardness Tester MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Santrifüj Pompa Eğitim Seti ZİRAAT FAKÜLTESİ Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Vakum etüvü MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
PH METRE MASA TİPİ TIP FAKÜLTESİ Doç.Dr. Sezgin GÜNEŞ (362)312-1919 BAP
Vakum pompası MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Aspiratör FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
DSLR Fotoğraf Makinesi için 24-105 mm Objektif+UV Filtre İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
DSLR Fotoğraf Makinesi için 70-200 mm Objektif+Uv Filtre İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Ahmet OKTAN (036)244-5113 BAP
Kitap VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
kitap VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
Derin dondurucu -86°C TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
El Dinamometresi HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Gonyometre Seti HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
imbik ADALET MESLEK YÜKSEK OKULU Doç.Dr. Ömer ÇALIŞKAN (362)542-6762 BAP
400 Litre Depo Kapasiteli Tarla Pülverizatörü ZİRAAT FAKÜLTESİ Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Meyve Eti Sertlik Ölçer (Penetrometre) Bilgisayara veri aktarabilen (6-8-11 mm uç ile) ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
bahçesi çizeli ZİRAAT FAKÜLTESİ Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
rötavatör ZİRAAT FAKÜLTESİ Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Osseopulse Biolux LED cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ OSSEOPULSE BIOLUX CANADA Doç.Dr. Emel BULUT (362)312-1919 BAP
SOĞUTMALI SANTRİFÜJ TIP FAKÜLTESİ Doç.Dr. Sezgin GÜNEŞ (362)312-1919 BAP
Kitap VETERİNER FAKÜLTESİ Dr.Öğr.Üyesi Banu YARDIMCI (362)312-1919 BAP
Kitap VETERİNER FAKÜLTESİ Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
2-[2-[chloro-3-[(1,3-dihydro-3,3 dimethyl-1-propyl-2h-indol-2-ylidene)ethylidene]-1-cyclohexen-1-yl]ethenyl]-3,3-dimethyl-1-propyl FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK (362)312-1919 BAP
3,3'diethylthiadicarbocyanine iodide FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK (362)312-1919 BAP
hydroxynaphthol blue FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK (362)312-1919 BAP
thorin FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK (362)312-1919 BAP
Antibiyotik diskleri VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
Kanlı Agar VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
L-Arabinoz VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
NPG (beta-glukozidaz) VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
ONPG (orto-nitrofenil-beta-galaktosidaz) VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
Ornitin Dekarboksilaz VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
Trehaloz VETERİNER FAKÜLTESİ Doç.Dr. Arzu FINDIK (362)312-1919 BAP
MITECH MFD 350 B Ultrasonik Hata Tayin Cihazı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Çekme Testi Eğitim Seti, Gunt WP300 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
50 lt Çelik Tüp MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Regülatör MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
SHORE D DİJİTAL SERTLİK CİHAZI , GIBITRE MARKA SHORE D DIGITAL HARDNESS CHECK MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
ÇOKLU NUMUNE KESME CİHAZİ ve KALIBI KOMPLE, GIBITRE MARKA MULTI DIE CUTTING ve DIE CUTTER MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Bilgisayar Desktop ZİRAAT FAKÜLTESİ PRO2000 Prof.Dr. Mehmet Akif ÇAM (362)312-1919/1364 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ CASPER Prof.Dr. Mehmet Akif ÇAM (362)312-1919/1364 BAP
Biyogüvenlik kabini (120cm) TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
CO2 inkübatör TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
Dijital görüntüleme sistemli faz-kontrast inverted mikroskop TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
Sıvı azot saklama tankı TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
Bitki öğütme değirmeni ADALET MESLEK YÜKSEK OKULU Doç.Dr. Ömer ÇALIŞKAN (362)542-6762 BAP
BİLGİSAYAR MÜHENDİSLİK FAKÜLTESİ DEM Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Helezon Tip Briketleme Makinası ZİRAAT FAKÜLTESİ Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Klorofilmetre ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Hakan ARSLAN (362)312-1919 BAP
Kumpas ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Hakan ARSLAN (362)312-1919 BAP
Ultrasonik su banyosu-3 lt ZİRAAT FAKÜLTESİ Prof.Dr. Muharrem ÖZCAN (362)312-1919 BAP
Fumonitest ® (VICAM) Immunoaffinity column adebt ZİRAAT FAKÜLTESİ Prof.Dr. Berna TUNALI (362)312-1919 BAP
Fotokopi Çekimi (Renkli ve siyah-beyaz) İLAHİYAT FAKÜLTESİ Doç.Dr. Recep GÜN 362 3121919-6103 BAP
Fresenius BCM (Vücut Kompozisyon Monitorü) elektrotu TIP FAKÜLTESİ Doç.Dr. Cengiz KARA (312)191-9310 BAP
JEL GÖRÜNTÜLEME CİHAZI TIP FAKÜLTESİ Doç.Dr. Sezgin GÜNEŞ (362)312-1919 BAP
NANODROP CİHAZI TIP FAKÜLTESİ Doç.Dr. Sezgin GÜNEŞ (362)312-1919 BAP
Vorteks FEN EDEBİYAT FAKÜLTESİ ULTRALAB UVOR/2 Prof.Dr. İbrahim ÖZKOÇ (036)231-2191 BAP
Akış Bölücü Valf MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Kemal YILDIZLI (036)312-1919 BAP
Dijital görüntü analiz programı ZİRAAT FAKÜLTESİ Prof.Dr. Erkut PEKŞEN (542)676-7494 BAP
Merdiven ZİRAAT FAKÜLTESİ Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Seramik Fırını (hacim 12 lt, en yüksek sıcaklık : 1600 °C) GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Dijital Fotoğraf Makinesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Kemalettin ŞAHİN (036)231-2191 BAP
Fotoğraf Makinasına Uyumlu Depolama Aygıtı (64GB) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Kemalettin ŞAHİN (036)231-2191 BAP
Tablet PC FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Kemalettin ŞAHİN (036)231-2191 BAP
3D Tarayıcı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
3D printer MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
An Introduction to Differential Geometry Yazar: Wilmore, T. J. FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Curvature in Mathematics and Physics Yazar: Shlomo Sternberg FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Geometry of Curves Yazar: john W. Rutter FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Lectures on Classical Differential Geometry Yazar: Dirk Jan Struik FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Modern Differential Geometry of Curves and Surfaces With Mathematica Yazarlar: Alfred Gray, Simon Salaman and Elsa Abbena FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Shape Interrogation For Computer Aided Design and Manufacturing Yazarlar: Nicholas M. Patrikalakis, Takashi Maekawa FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Boy Ölçerli Hassas Medikal Terazi DİŞ HEKİMLİĞİ FAKÜLTESİ SECA 769 Dr.Öğr.Üyesi Sezin ÖZER (362)312-1919 BAP
Dijital Kamera (Sony Handycam) EĞİTİM FAKÜLTESİ SONY HDR-P1270 Dr.Öğr.Üyesi Elif Omca ÇOBANOĞLU (362)312-1919 BAP
Hektolitre Seti 250 lik ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi İsmail SEZER (362)3121919-1174 BAP
Tablet (1 GB, 8GB 7") EĞİTİM FAKÜLTESİ E2COOL25166 8" Dr.Öğr.Üyesi Elif Omca ÇOBANOĞLU (362)312-1919 BAP
Taşınabilir Hard disk (500 GB, USB 3.0 ) EĞİTİM FAKÜLTESİ SEAGATE SLİMSTCD500202 Dr.Öğr.Üyesi Elif Omca ÇOBANOĞLU (362)312-1919 BAP
Dijital Ses Kayıt Cihazı İLETİŞİM FAKÜLTESİ OLYMPUS VN-732PC Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Dizüstü Bilgisayar İLETİŞİM FAKÜLTESİ ASUS X550JK-XO012D Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
El Tipi Kamera Telsiz Mikrofon Seti İLETİŞİM FAKÜLTESİ SENNHEİSER EW135P-G3 Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Güç Kaynağı İLETİŞİM FAKÜLTESİ POWERFUL 1500 VA Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
HD Video Kamera İLETİŞİM FAKÜLTESİ SONY HXR-NX30E Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Masaüstü Bilgisayar İLETİŞİM FAKÜLTESİ ASUS PC M70AD-TR005S Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Renkli Yazıcı / Fotokopi / Faks / Tarayıcı İLETİŞİM FAKÜLTESİ HPCN598A Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Siyah-Beyaz Yazıcı İLETİŞİM FAKÜLTESİ HPCE461A Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Yüksek Kalite Ses Kayıt Cihazı İLETİŞİM FAKÜLTESİ ZOOM H4N Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Fotoğraf Makinesi ve Aksesuarları (Düşük Model) İLETİŞİM FAKÜLTESİ CANON 700D BODY (700D SET) Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Fotoğraf Makinesi ve Aksesuarları (Yüksek Model) İLETİŞİM FAKÜLTESİ CANON 70D BODY (70 D SET) Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Profesyonel Tripod İLETİŞİM FAKÜLTESİ 500 HD Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Mac Uyumlu Taşınabilir DVD Yazıcı İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Tablet İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
iMac Bilgisayar (Düşük Model) İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
iMac Bilgisayar (Yüksek Model) İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Beste Nigar ERDEM (362)445-1138 BAP
Su Motoru ZİRAAT FAKÜLTESİ Doç.Dr. Şahane Funda ARSLANOĞLU (362)312-1919 BAP
Seramik ve porselen fırını (hacim:300 lt, en yüksek sıcaklık: 1340 °C) GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Full HD Endovizyon görüntüleme sistemi TIP FAKÜLTESİ Prof.Dr. Burak TANDER (362)312-1919 BAP
HD Video Kamera EĞİTİM FAKÜLTESİ CANON HFR506 Doç.Dr. Melek KALKAN (362)312-1919 BAP
Projeksiyon cihazı EĞİTİM FAKÜLTESİ ACER 113 Doç.Dr. Melek KALKAN (362)312-1919 BAP
Araştırma mikroskobu TIP FAKÜLTESİ Doç.Dr. Berrin Zuhal ALTUNKAYNAK (312)191-9226 BAP
Araştırma mikroskobu için kamera ataçmanı TIP FAKÜLTESİ Doç.Dr. Berrin Zuhal ALTUNKAYNAK (312)191-9226 BAP
Kesintisiz Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ INFORM Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Split Klima MÜHENDİSLİK FAKÜLTESİ VESTEL Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Sunucu Kabini MÜHENDİSLİK FAKÜLTESİ ESTAB Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Akülü vidalama makinası MÜHENDİSLİK FAKÜLTESİ BOSCH IXO4 Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
Etiket yazıcı MÜHENDİSLİK FAKÜLTESİ DYMO LETRA TAB Dr.Öğr.Üyesi Recai OKTAŞ (362)312-1919 BAP
HP OfficeJet 7500A e-AIO A3 Faks + Fotokopi + Tarayıcı + Yazıcı + Wi-Fi C9309A MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Erdem Emin MARAŞ (362)312-1919 BAP
Ses Kayıt Cihazı EĞİTİM FAKÜLTESİ SONY ICD-BX140 Doç.Dr. Melek KALKAN (362)312-1919 BAP
Çok kesitli bilgisayarlı tomografi cihazı TIP FAKÜLTESİ Prof.Dr. Ümit BELET (362)312-1919 BAP
Jel Görüntüleme Sistemi ZİRAAT FAKÜLTESİ SYNGENE IG3 Dr.Öğr.Üyesi Musa KAVAS (362)312-1919 BAP
Led Işık Kaynağı DİŞ HEKİMLİĞİ FAKÜLTESİ 3M ELİPAR S.10 Dr.Öğr.Üyesi Fikret YILMAZ (362)312-1919 BAP
Bilyalı değirmen GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
dijital vitalometre DİŞ HEKİMLİĞİ FAKÜLTESİ PARKELL DİGİTEST II Doç.Dr. Ayça Tuba Ulusoy YAMAK (362)312-1919 BAP
25 ml'lik otomatik titrasyon büreti MÜHENDİSLİK FAKÜLTESİ ISOLAB Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
küçük karıştırıcı MÜHENDİSLİK FAKÜLTESİ ISOLAB Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
Nemlendirici kit sistem(Nem kontrol cihazı dahil) MÜHENDİSLİK FAKÜLTESİ İNC-10 KİT Doç.Dr. Hakan ÖZCAN (362)312-1919 BAP
Oksijen Konsantratörü(tank ve debimetresi dahil) MÜHENDİSLİK FAKÜLTESİ MK LİFE Doç.Dr. Hakan ÖZCAN (362)312-1919 BAP
Alçı tornası GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Grafik Tablet İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ HANNON ARTMASTER IV A5+ Dr.Öğr.Üyesi Ahmet Serhat ULUDAĞ 6262 BAP
Hassas terazi GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Kompressör (50 Lt) GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Masa üstü turnet GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Seyyar çamur karıştırıcı GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Soğutmalı İnkübatör ZİRAAT FAKÜLTESİ MEMMERT IPP55 Dr.Öğr.Üyesi Aslıhan Kurt KIZILDOĞAN (362)312-1919 BAP
Sulu sistem sırlama kabini GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Sır değirmeni (jet değirmen) GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Sır tabancası GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
pH metre ZİRAAT FAKÜLTESİ CONSORT Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
Çömlekçi tornası GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
K4 B2 INT TX (MOBIL CPET) 19 Mayıs Samsun Devlet Konservatuvarı Prof.Dr. Seydi Ahmet AĞAOĞLU (362)312-1919 BAP
Oksijen kontrollü CO2 inkübatör TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN (362)312-1919 BAP
Tam donanımlı ameliyat masası TIP FAKÜLTESİ Prof.Dr. Ahmet PİŞKİN (362)312-1919 BAP
Yüksek işlem kapasiteli Masaüstü bilgisayar (Malzeme Modelleme ve simülasyon laboratuvarı kurulumu için) MÜHENDİSLİK FAKÜLTESİ DELLXPS8700 Doç.Dr. Engin BURGAZ (362)312-1919 BAP
cerrahi ameliyat mikroskobu TIP FAKÜLTESİ Doç.Dr. Rıfat KARLI (362)312-1919 BAP
ArcGIS 3D Analyst for Desktop Concurrent Use Educational Teaching and Research Lab Kit Lisansı (Tek Kullanıcılı) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Faik Ahmet SESLİ (362)312-1919 BAP
ArcGIS Spatial Analyst for Desktop Concurrent Use Educational Teaching and Research Lab Kit Lisansı (Tek Kullanıcılı) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Faik Ahmet SESLİ (362)312-1919 BAP
ArcGIS for Desktop Advanced (ArcInfo) Concurrent Use Educational Teaching and Research Lab Kit Lisansı (Tek Kullanıcılı) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Faik Ahmet SESLİ (362)312-1919 BAP
Labaratuar için -86 dondurucu DİŞ HEKİMLİĞİ FAKÜLTESİ Nüve Marka, DF 290 Mod. Doç.Dr. Burcu BAŞ (312)312-1919 BAP
direct soil pH metre TEMPLOG TL-300B MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
saf su cihazı FEN EDEBİYAT FAKÜLTESİ MİPRO PDUP MODEL Doç.Dr. Yasemin ÖZDENER KÖMPE (036)231-2191 BAP
Laserjet yazıcı (tonerli, tarayıcılı ve fotokopi özellikli) Samsun Sağlık Yüksekokulu SAMSUNG SL-M2070 FW Dr.Öğr.Üyesi Osman ŞALIŞ (036)231-2191 BAP
NO FROST BUZDOLABI ZİRAAT FAKÜLTESİ HOTPOİNT 86489 ENXTGH Dr.Öğr.Üyesi Aslıhan Kurt KIZILDOĞAN (362)312-1919 BAP
Kesintisiz Güç Kaynağı (Malzeme Modelleme ve simülasyon laboratuvarı kurulumu için) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Ağız içi (micro) Kumlama Cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Çağrı URAL (362)312-1919 BAP
Bilgisayar DİŞ HEKİMLİĞİ FAKÜLTESİ MACBOOK PRO MF839 TU/A Dr.Öğr.Üyesi Aslıhan Zeynep ÖZ 3121919-3025 BAP
Liyofilizatör TIP FAKÜLTESİ TELSTAR LYOQUEST-55 PLUS ECO Dr.Öğr.Üyesi Adil KARADAĞ (362)312-1919 BAP
Faks Özellikli Siyah Beyaz Çok Fonksiyonlu Lazer Yazıcı ZİRAAT FAKÜLTESİ BROTHER MFC 8510 DN Dr.Öğr.Üyesi Yılmaz KAYA 1362 BAP
Multimetre MÜHENDİSLİK FAKÜLTESİ PEAKTECH P3335 Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Mutfak tezgahı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Su tesisatı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Vakum fırını MÜHENDİSLİK FAKÜLTESİ NÜVE EV018 Doç.Dr. Engin BURGAZ (362)312-1919 BAP
pH Metre VETERİNER FAKÜLTESİ METTLER TOLEDO ,S210-U Doç.Dr. Mustafa SALMAN (362)312-1919 BAP
vorteks ZİRAAT FAKÜLTESİ VELP ZX4 Dr.Öğr.Üyesi Aslıhan Kurt KIZILDOĞAN (362)312-1919 BAP
jel tankı ve güç kaynağı ZİRAAT FAKÜLTESİ BIORAD Prof.Dr. Ahmet OKUMUŞ (362)312-1919 BAP
Bilgisayar Desktop HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ASUS D310MT-TR3110 Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Laptop Bilgisayar HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ LONOVO M30-70 Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Yüksek işlem kapasiteli Masaüstü bilgisayar (Malzeme Modelleme ve simülasyon laboratuvarı kurulumu için) MÜHENDİSLİK FAKÜLTESİ DELL 2720-t77 w162 Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Pipet Seti (05-10ul, 10-100ul, 100-1000ul) Samsun Sağlık Yüksekokulu Dr.Öğr.Üyesi Osman ŞALIŞ (036)231-2191 BAP
Pipet Seti dijital 8'li ayarlı (20-200 ul) Samsun Sağlık Yüksekokulu Dr.Öğr.Üyesi Osman ŞALIŞ (036)231-2191 BAP
Pipet Seti dijital ayarlı (20-200 ul) Samsun Sağlık Yüksekokulu Dr.Öğr.Üyesi Osman ŞALIŞ (036)231-2191 BAP
LAB. ÖLÇEKLİ DEAD-END SİSTEM MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Gülfem BAKAN (362)312-1919 BAP
1 TB 2.5" USB 3.0/2.0 taşınabilir Disk ŞEVKET AŞÇI TURİZM FAKÜLTESİ 1TB SAMSUNG Dr.Öğr.Üyesi Yasin KELEŞ 3623121919 BAP
32 GB USB bellek ŞEVKET AŞÇI TURİZM FAKÜLTESİ KİNGSTON 32GBD TU3063 Dr.Öğr.Üyesi Yasin KELEŞ 3623121919 BAP
BROTHER DCP J105 Yazıcı ŞEVKET AŞÇI TURİZM FAKÜLTESİ BROTHER J105W Dr.Öğr.Üyesi Yasin KELEŞ 3623121919 BAP
Dizüstü Bilgisayar, A i5 8GB 256 G 13.3 İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ LENOVA YOGA560 Dr.Öğr.Üyesi Ahmet Serhat ULUDAĞ 6262 BAP
DİZÜSTÜ BİLGİSAYAR (ASUS K555LN CORE İ7) ŞEVKET AŞÇI TURİZM FAKÜLTESİ DELL İ7 5500 WM Dr.Öğr.Üyesi Yasin KELEŞ 3623121919 BAP
Taşınabilir Disk, 1 TB İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ 1TB SAMSUNG Dr.Öğr.Üyesi Ahmet Serhat ULUDAĞ 6262 BAP
ÇOK İŞLEVLİ RENKLİ YAZICI+KARTUŞ TAKIMI İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ BROTHER MCF 3720 Dr.Öğr.Üyesi Ahmet Serhat ULUDAĞ 6262 BAP
Çok fonksiyonlu yazıcı (1 adet) İLAHİYAT FAKÜLTESİ BROTHER DCP-1511 Prof.Dr. Yaşar KURT (362) 457-6084 / 6127 BAP
Fotoğraf Makinesi ve Aksesuarları (Düşük Model) İLETİŞİM FAKÜLTESİ CANON EOS 700D 18-135 KİT Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Fotoğraf Makinesi ve Aksesuarları (Yüksek Model) İLETİŞİM FAKÜLTESİ CANON EOS 700 18-135 KİT Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
DİZÜSTÜ BİLGİSAYAR İLETİŞİM FAKÜLTESİ ASUS X550JX-XX099D İ5-4200H Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Güç Kaynağı İLETİŞİM FAKÜLTESİ MAKELSAN LION 1500VA Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
LCD Monitör İLETİŞİM FAKÜLTESİ ASUS 21.5VS 228DE Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Masaüstü bilgisayar İLETİŞİM FAKÜLTESİ ASUS M70AD Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Projeksiyon İLETİŞİM FAKÜLTESİ SONY VPL-DX122 Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Projeksiyon perdesi İLETİŞİM FAKÜLTESİ CODEGEN XGT-200 Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Renkli Yazıcı / Fotokopi / Faks / Tarayıcı İLETİŞİM FAKÜLTESİ HPX576DW Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Siyah beyaz yazıcı İLETİŞİM FAKÜLTESİ LEXMARK MS310DN Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Ahkamü'l-Kur'an Cessas daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Bedaiu's-sanai' Kasani daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Devletin Egemenlik Usuru ve Egemenlikten Kaynaklanan Yetkileri Talip Türcan ankara okulu yayınları İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Devletler ve İslam Hukukunda Deniz Hakkı Aydın Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Düşünerek İnanmak Faruk Beşer Nun İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Fıkhi ve İktisadi Açıdan İslami Finans Servet Bayındır Süleymaniye Vakfı Yayınları İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Fıkhu Muhammed b. hasan eş-şeybani Ferkad eş-Şeybani daru's-selam İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Fıkıh İlminin Oluşum Sürecinde İcma Bilal Aybakan İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Haccın manası Ali Bakkal Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Kenzü'd-dekâik Ebu'l-Nerekât en-Nesefi mektebetü'l-büşra İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Kur'an ve Sünnete Göre Mut'a Nikahı Saffet Köse Timaş İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Kurban Kitabı Murteza Bedir Ensar İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Kölelikten Önderliğe Ali Bakkal Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Makasıd ve İctihad Ahmet Yaman Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Mezheplerin Doğuşu ve İçtihat Tartışması Şükrü Özen Pınar İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Mizanü'l-usul Semerkandi - İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Muhtasaru't-tahavi Ebu Cafer et-Tahavi daru ihyai'l-ulum İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Müslüman Gayr-i Müslim Evliliği Nihat dalgın etüt İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Siyaset ve Fıkıh Ahmet Yaman İz İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Sünnet hz. Peygamber'in Evrensel Mesajı Murteza Bedir isam İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Tebyinü'l-Hakaik Zeylai daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Usulü'l-Pezdevi Pezdevi - İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Usulü'l-cessas Cessas daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
el-Camiu'l-kebir Ferkad eş-Şeybani daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
el-Câmüu's-sağir Ferkad eş-Şeybani daru ibn hazm İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
el-Hidaye şerhu bidayeti'l-mübtedi Merginani el-Mektebetü'l-hanefiyye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
el-mebsut Serahsi daru'l-kütübi'l-ilmiiye İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
islam Fıkıh Mezhepleri Ali Bakkal Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
islam ilmihali fahrettin Atar ifav İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
islamda Tebe ve Cezalara Etkisi Nihat dalgın İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
nassları anlama ve yorumlamada yöntem sorunu Adnan Koşum iz İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
zekat kitabı Mehmet Günay Ensar İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Çağdaş İhtiyaçlar ve İslam Hukuku Saffet Köse Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Özel Hayatın Gizliliği Abdullah Kahraman Ebabil İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İbadetler Allah'ın Müminlerle Buluşması Selahaddin Eroğlu Akçağ İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İmam Şafii ve Fıkıh Düşüncesinin mezhepleşmesi İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Aile Hukuku Ahmet Yaman İfav İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Borçlar Hukukunda Kefalet Sözleşmesi ve Günümüzdeki Tatbikatı Abdullah Kahraman İfav İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukuk Biliminde Norm-Amaç İlişkisi Talip Türcan ankara okulu yayınları İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukuk Düşüncesinde sedd-i Zerai Şevket Topal Ensar İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukuk Metodolojisinde Tahsis/Daraltıcı Yorum Ferhat Koca isam/İslam araştırmları merkezi İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukuk Tarihinde Selefi Söylem Hanbeli Mezhebi Ferhat Koca ankara okulu yayınları İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukukunda Boşama Yetkisi Nihat dalgın İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukukunda Değişim Abdullah Kahraman Ensar İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukukunda Yargılama Etiği ve İlkeleri Nasi Aslan karahan İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukukunda Çocuk ve Hakları Orhan Çeker Kayıhan İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Hukukunda Ülke Kavramı Ahmet Özel İz İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Muhakemesi Hukuku Açısından İslam İspat Hukuku Sahip Beroje Fecr İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam Sorumluluk Hukuku Akit Dışı Sorumluluk Kemal Yıldız İfav İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
İslam ve Terör/Fıkhi Bir Yaklaşım Ahmet Özel Küre İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Şatıbî'de Makasıd ve Fıkıh usulü Abdurrahman Haçkalı Rağbet İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
Şerhu fethu'l-kadir İbnü'l-hümam daru'l-kütübi'l-ilmiiye 253,73 İLAHİYAT FAKÜLTESİ Dr.Öğr.Üyesi Ayhan AK 3623121919 BAP
flor elektrodu VETERİNER FAKÜLTESİ THERMO SCIENTIFIC ORION Prof.Dr. Ali ERTEKİN 03624576921 BAP
Multiscan GO MÜHENDİSLİK FAKÜLTESİ THERMO SCIENTIFIK MULTISCAN GO Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
Ses Kayıt Cihazı ZİRAAT FAKÜLTESİ SONY ICD-TX650 Doç.Dr. Kürşat DEMIRYÜREK (362)312-1919 BAP
Apple iMac Intel Core i5 Bilgisayar İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Apple İmac İntel Core i7 Bilgisayar İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
DSC cihazı örnek hazırlama aparatı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Talip KAHYAOĞLU (362)312-1919 BAP
Desen Dolabı GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Dijital Ses Kayıt Cihazı İLETİŞİM FAKÜLTESİ OLYMPUS WS-852 4 GB Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Duyargarlı Toprak Frezesi ZİRAAT FAKÜLTESİ YÜKSAN Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
El Tipi Kamera Telsiz Mikrofon Seti İLETİŞİM FAKÜLTESİ SENNHEİSER EW-135P-G3 Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Elektrosprey ünitesi MÜHENDİSLİK FAKÜLTESİ İNOVENSO BASİC SYSTEM Dr.Öğr.Üyesi Mevlüt GÜRBÜZ (362)312-1919 BAP
Etüv ZİRAAT FAKÜLTESİ BİNDER ED 115 Doç.Dr. İsmail SEZER (362)3121919-1174 BAP
HD Video Kamera İLETİŞİM FAKÜLTESİ SONY X70 Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Harici Hard Disk İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Krom Evye GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Mac uyumlu taşınabilir DVD yazıcı İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Raf Sistemi GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Spin coater FEN EDEBİYAT FAKÜLTESİ LAUREL WS400B-6NPP Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Tablet bilgisayar İLETİŞİM FAKÜLTESİ Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Tabure GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Yazıcı(A7F64A) MÜHENDİSLİK FAKÜLTESİ SAMSUNG SL-M2020 Doç.Dr. Faik Ahmet SESLİ (362)312-1919 BAP
Yüksek Kalite Ses Kayıt Cihazı İLETİŞİM FAKÜLTESİ ZOOM H4n Dr.Öğr.Üyesi Özlem AKGÜÇ ÇETİNKAYA (362)312-1919 BAP
Yüksek işlem kapasiteli Dizüstü Bilgisayar (Malzeme Modelleme ve simülasyon laboratuvarı kurulumu için) MÜHENDİSLİK FAKÜLTESİ MSIGS60-2QD-602TR Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Çalışma Sehpası GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Şövale GÜZEL SANATLAR FAKÜLTESİ Prof.Dr. Metin EKER (362)457-5766 BAP
Hassas terazi MÜHENDİSLİK FAKÜLTESİ SARTORİUS SIWRDCP-1-35-1 Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Hava tüpü MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Regülatör MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
KERR MARKA ENDO-BİTE X-RAY FİLM TUTUCU DİŞ HEKİMLİĞİ FAKÜLTESİ KERR Doç.Dr. Ayça Tuba Ulusoy YAMAK (362)312-1919 BAP
Mac OSX tabanlı bilgisayar TIP FAKÜLTESİ iMac 27"5k Doç.Dr. Berrin Zuhal ALTUNKAYNAK (312)191-9226 BAP
3 Boyutlu Yazıcı Limit Switch - End Stop - Ramps 1.4 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
A4988 Step Motor Sürücü Kartı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
Arduino Mega 2560 R3 Mikro İşlemci MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
Derin Dondurucu (- 86 ?C'lik) ZİRAAT FAKÜLTESİ UUS-480A Doç.Dr. Hasan Murat AKSOY (312)191-9134 BAP
DİZÜSTÜ BİLGİSAYAR ZİRAAT FAKÜLTESİ DELL INSPRON5558/S20W45C Dr.Öğr.Üyesi Umut Sami YAMAK (362)312-1919 BAP
GTEN R1605 FSU Somun MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
GTEN R1605*400mm vidalı mil MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
HerkuleX DRS-0101 Smart Servo motor MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
LEADSHINE 42HS02 Step Motor MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
LSK GL 15 CA Dar Araba MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
LSK SS15*400mm Ray MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
MEDİKAL GÖRÜNTÜLEME İŞ İSTASYONU DONANIMI İÇİN 8 AD.PC VE 10 AD.MONİTÖR TIP FAKÜLTESİ ODAK (10 AD. MONİTÖR 36.800 TL), E.S.C. (8 AD. PC)(19.840 TL) Prof.Dr. Ümit BELET (362)312-1919 BAP
Mini PC TIP FAKÜLTESİ APPLE MAC MİNİ MGEN2TU/A Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
R+W EKL 10 Pilot Delikli Kaplin MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
RepRap Ramps 1.4 3D Printer Kontrol Kartı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
RepRap Ramps 1.4 Uyumlu 128x64 Grafik GLCD Ekran Kiti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Fatih YAPICI 3623121919 BAP
SANTRİFÜJ CİHAZI DİŞ HEKİMLİĞİ FAKÜLTESİ HETTİCH EBA 20 Dr.Öğr.Üyesi İlker KESKİNER (362)312-1919 BAP
23" 1920x1080 çözünürlüğe sahip geniş ekran LED IPS monitör EĞİTİM FAKÜLTESİ DELL U2414 H Dr.Öğr.Üyesi Ayşenur BÜYÜKGÖZE KAVAS (362)312-1919 BAP
BİYOGÜVENLİK KABİNİ TIP FAKÜLTESİ METİSAFE CLASSII B2MSC120 Prof.Dr. Ahmet Yilmaz ÇOBAN (362)312-1919 BAP
COMSOL Multiphysics Yazılım Lisansı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Giyotin TIP FAKÜLTESİ WPI Prof.Dr. Erdal AĞAR (362)312-1919 BAP
Sta4CAD V13.1 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Arazi Terazisi ZİRAAT FAKÜLTESİ RADWAG WLC/20/Z2 Doç.Dr. Şahane Funda ARSLANOĞLU (362)312-1919 BAP
Clevenger hidrodestilasyon düzeneği MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sadettin TURHAN (362)312-1919 BAP
FOTOĞRAF MAKİNESİ ZİRAAT FAKÜLTESİ NİKON D3200 Dr.Öğr.Üyesi Yılmaz KAYA 1362 BAP
VGA Monitör Çoklayıcı+2adet 20m vga+bağlantı aparatları.( MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
İş İstasyonu MÜHENDİSLİK FAKÜLTESİ DELL PREDISION T7810 (v7) Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
2.800 Ansilümen 800x600 3D Projeksiyon MÜHENDİSLİK FAKÜLTESİ ACER X113DLP Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
HAREKETLİ RAF(200X100X75 CM) ZİRAAT FAKÜLTESİ Prof.Dr. Hatice BOZOĞLU (036)312-1919 BAP
PACS donanım TIP FAKÜLTESİ Prof.Dr. Ümit BELET (362)312-1919 BAP
Renkli Laser Yazıcı MÜHENDİSLİK FAKÜLTESİ OKİ C301 Prof.Dr. Sebahattin BEKTAŞ (362)312-1919 BAP
SABİT RAF (200X100X75 CM) ZİRAAT FAKÜLTESİ Prof.Dr. Hatice BOZOĞLU (036)312-1919 BAP
1 ADET ANFİ+2 ADET HOP.+1 ADET MASA ÜSTÜ MİKROFONU++KABLOLAMA+APARATLAR. MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İbrahim KELEŞ (362)312-1919 BAP
Reometre için plate-plate aksesuarı MÜHENDİSLİK FAKÜLTESİ PLATE P35 Ti L for RV/RS/MARS Doç.Dr. Talip KAHYAOĞLU (362)312-1919 BAP
RISC 5 download Modeli MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Emre Burcu GÜNGÖR (362)312-1919 BAP
Bilgisayar kasası TIP FAKÜLTESİ Doç.Dr. Berrin Zuhal ALTUNKAYNAK (312)191-9226 BAP
Bilgisayar monitorü TIP FAKÜLTESİ Doç.Dr. Berrin Zuhal ALTUNKAYNAK (312)191-9226 BAP
Lazer Yazıcı Tarayıcı Fotokopi EĞİTİM FAKÜLTESİ HPCF485A Dr.Öğr.Üyesi Salih RAKAP (530)462-9173 BAP
Tablet bilgisayar EĞİTİM FAKÜLTESİ IPAD AIR2 MGLW2TY/A Dr.Öğr.Üyesi Salih RAKAP (530)462-9173 BAP
Ağız içi okuma cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ SİRONA Doç.Dr. Ali KELEŞ 03626121919 BAP
ENKAPSÜLATÖR ZİRAAT FAKÜLTESİ BUCHİ B-390 Prof.Dr. Ergin ÖZTÜRK (0362)3121919-1144 BAP
Frezleme cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ SİRONA Doç.Dr. Ali KELEŞ 03626121919 BAP
Magnetik karıştırıcı ZİRAAT FAKÜLTESİ MTOPS MS300HS Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
bitki kabini ZİRAAT FAKÜLTESİ NÜVE GC 400 Dr.Öğr.Üyesi Yılmaz KAYA 1362 BAP
Taşınabilir Bilgisayar Sivil Havacılık Yüksekokulu MONSTER ABRA A5 V5.2 Dr.Öğr.Üyesi Ferhat AKYÜZ (362)511-4710 BAP
Çok fonksiyonlu yazıcı Sivil Havacılık Yüksekokulu HP CZ172A Dr.Öğr.Üyesi Ferhat AKYÜZ (362)511-4710 BAP
ABS KABUKLU BARET HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ALÇAK GERİLİM İZOLE ELDİVEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
AĞIRLIK KALDIRMA BEL KEMERİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
AŞÇI PANTOLONU HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
BARETE MONTE ELEKTRONİK OTOMATİK KAYNAKÇI MASKESİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
BEL DESTEKLİ PARAŞÜT TİPİ EMNİYET KEMERİ EMNİYET KEMERİ (PARAŞÜT TİPİ) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
CANSIZ MANKEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
DÜŞÜŞ ENGELLEYİCİ EMNİYET KEMERİ HALAT HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
DİZ ALTI ÇİZME HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ELEKTRİK ARKLARINA VE ALEVE KARŞI KORUYUCU ELBİSE HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ELEKTRİKÇİ İŞ AYAKKABISI HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
GRİ LENSLİ KORUYUCU GÖZLÜK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
HALAT FRENLEME SİSTEMİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
HDPE KABUKLU BARET HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ISI VE ALEVE DAYANIKLI TEK PARMAK ELDİVEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KASK BARET HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI AYAKKABISI HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI EL MASKESİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI GÖZLÜĞÜ (TAM KORUMA) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI KOLLUĞU HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI TOZLUĞU HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KAYNAKÇI ÖNLÜĞÜ (KROME DERİDEN) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KİMYASAL KORUYUCU TULUM HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KİMYASALLARA DAYANIKLI ( NEOPREN) ÖNLÜK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
NEOPREN BOY ÇİZMESİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
PARAARAMİD ELDİVEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
PARAŞÜT TİPİ EMNİYET KEMERİ İÇİN ÇİFT KOLLU HALAT HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
PARAŞÜT TİPİ EMNİYET KEMERİ İÇİN ÇİFT KOLLU ŞOK EMİCİLİ HALAT HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
PERSONEL GÜVENLİK HALATI HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
S4 ÇELİK BURUNLU DİZ BOYU ÇİZME HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
SARI LENSLİ KORUYUCU GÖZLÜK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
TAM KORUMA GÖZLÜĞÜ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
TAM YÜZ MASKE HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
TERMAL İÇ GİYSİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
UYARI İŞARET VE LEVHALARI ( 25cm x 35 cm Ebatlarında) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YARIM YÜZ MASKE HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YAĞMURLUK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YOL VE ÇEVRE GÜV. TRAFİK KONİSİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YÜKSEK GERİLİM İZOLE ELDİVEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YÜKSEK GÖRÜNÜRLÜKLÜ MONT HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YÜKSEK GÖRÜNÜRLÜKLÜ YELEK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YÜKSEK GÖRÜNÜRLÜKLÜ ÇİFT BANTLI İKAZ YELEĞİ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
YÜKSEKTE ÇALIŞMALARDA KULLANILAN YATAY YAŞAM HATTI HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ÇELİK ÖRGÜ ELDİVEN HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ÇOK AMAÇLI YÜKSEK GÖRÜNÜRLÜKLÜ KORUYUCU ELBİSE HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
İŞ AYAKKABISI HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
İŞ BOTU HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
İŞ ÖNLÜĞÜ HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
ŞEFFAF LENSLİ KORUYUCU GÖZLÜK HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
KİMYASAL MADDE DOLABI MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
Rat TIP FAKÜLTESİ Dr.Öğr.Üyesi Ilkay BOZKURT 2937 BAP
ÇEKER OCAK MÜHENDİSLİK FAKÜLTESİ ITK Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
Flowbility Tester MÜHENDİSLİK FAKÜLTESİ TORONTETECH FT01 Prof.Dr. Muhammet DERVİŞOĞLU (362)312-1919 BAP
Işıklı fizyodispenser DİŞ HEKİMLİĞİ FAKÜLTESİ NSK Prof.Dr. Mehtap MUĞLALI (362)312-1919 BAP
LAPTOP MÜHENDİSLİK FAKÜLTESİ HP250 G3L3Q O3ES Prof.Dr. Sebahattin BEKTAŞ (362)312-1919 BAP
Piezo elektrik cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ MECTRON Prof.Dr. Mehtap MUĞLALI (362)312-1919 BAP
Portatif Jeneratör MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Tekerlekli metal alet rafı DİŞ HEKİMLİĞİ FAKÜLTESİ ERMETAL Prof.Dr. Mehtap MUĞLALI (362)312-1919 BAP
Yüksek grafik çözünürlüklü masaüstü PC (3D PRINTER VE 3D TARAYICIYA BAĞLANARAK BU CİHAZLARIN KULLANILMASI İÇİN) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
Yüksek işlem kapasiteli Masaüstü bilgisayar (Malzeme Modelleme ve simülasyon laboratuvarı kurulumu için) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ (362)312-1919 BAP
BÜYÜK TABLALI ISITICI 600x300 mm MÜHENDİSLİK FAKÜLTESİ DAİHAN SMHS 6 Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
SAF SU CİHAZI MÜHENDİSLİK FAKÜLTESİ NÜVE NS 103 Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
TABLALI ISITICI 300x300 mm MÜHENDİSLİK FAKÜLTESİ DAİHAN MSH-30 D Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
Blok Trimleme Cihazı TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Boyama Cihazı TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Elektron Mikroskobik Doku Takip Cihazı TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Knifemaker TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Kryo Mikrotom Ataçmanı TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
Shear Wave SuperSonic Ultrasound Elastography TIP FAKÜLTESİ Doç.Dr. Meltem CEYHAN BİLGİCİ (362)312-1919 BAP
Tomosentezli Mamografi cihazı TIP FAKÜLTESİ Doç.Dr. Ahmet Veysel POLAT (362)312-1919 BAP
Ultramikrotom TIP FAKÜLTESİ Prof.Dr. Süleyman KAPLAN (362)312-1919 BAP
laparoskopik problu ultrasonografi cihazı TIP FAKÜLTESİ Doç.Dr. İlhan KARABICAK (362)312-1919 BAP
Duktoskopi Seti+full aksesuar TIP FAKÜLTESİ Doç.Dr. Ayfer Kamalı POLAT (362)312-1919 BAP
Havalandırma sistemi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
Laktat Analizörü, Laktat Plus, USA (300 adet strip dahil) 25'lik 12 kutu YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ LAKTAT PLUS Doç.Dr. Tülin ATAN (362)312-1919 BAP
Nabız Monitörü Polar Saat V800 YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ POLAR Doç.Dr. Tülin ATAN (362)312-1919 BAP
Azot gazı tüpü, %99.999, 50 L MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
-20° Derin dondurucu TIP FAKÜLTESİ Öğr.Gör.Dr. Şengül TURAL (362)312-1919 BAP
Buzdolabı TIP FAKÜLTESİ Öğr.Gör.Dr. Şengül TURAL (362)312-1919 BAP
KART OKUMA CİHAZLARI (Diver için okuma ünitesi) FEN EDEBİYAT FAKÜLTESİ EİJKELKAMP 11110103 Prof.Dr. H. Güray KUTBAY (362)312-1919 BAP
Toprak piston örnekleme burgusu (5 m'lik) (Diver montajı için) FEN EDEBİYAT FAKÜLTESİ EİJKELKAMP 0109SAM Prof.Dr. H. Güray KUTBAY (362)312-1919 BAP
YERALTI SU SEVİYESİ RASAT ALETLERİ (Diver yer altı suyu veri kaydedici) FEN EDEBİYAT FAKÜLTESİ EİJKELKAMP 11110102 Prof.Dr. H. Güray KUTBAY (362)312-1919 BAP
ÇØ 1 mm paslanmaz çelik kablo için paslanmaz çelik klemens FEN EDEBİYAT FAKÜLTESİ EİJKELKAMP 111120 Prof.Dr. H. Güray KUTBAY (362)312-1919 BAP
Ø 1 mm 50 m'lik paslanmaz çelik halat FEN EDEBİYAT FAKÜLTESİ EİJKELKAMP 111121 Prof.Dr. H. Güray KUTBAY (362)312-1919 BAP
ISITICILI MANYETİK KARIŞTIRICI KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ STUART UC152D Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
OTOMATİK PİPET 0,1-2,5ul KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ EPPENDORF 3120000.011 Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
OTOMATİK PİPET 1-10ml KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ EPPENDORF 3120 000.089 Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
PH METRE, MASAÜSTÜ PH/Mv /SICAKLIK ÖLÇÜM CİHAZI KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
TZERO LİDS (TA İNS.) KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
TZERO PANS (TA İNS.) KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
DİSPANSER, (ORGANİK ve VANALI) KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ ISOLAB Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
PERSONEL DOZİMETRİ KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
Sıcaklık-Nem Kaydedici (Data logger) Samsun Meslek Yüksekokulu ONSET Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
Yaprak ıslaklığı kontrol cihazı Samsun Meslek Yüksekokulu TARTES Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
Multipycnometer(Gas Regulator, Helyum gaz Tüpü dahil) MÜHENDİSLİK FAKÜLTESİ QUANTACROME Prof.Dr. Muhammet DERVİŞOĞLU (362)312-1919 BAP
DİZÜSTÜ BİLGİSAYAR ZİRAAT FAKÜLTESİ TOSHİBA X70-B-117 Doç.Dr. Hasan ÖNDER (362)312-1919 BAP
HASSAS ANALİTİK TERAZİ (4 basamak) KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ OHAUS AX224 Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
MİKROSKOP KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ OLYMPUSCX31TR Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
Öğütücü Değirmen ZİRAAT FAKÜLTESİ HM 210 ERKAYA Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Düşen seviyeli permeabilite test seti. MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM S222 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Kum Konisi deney seti. MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM S218/4 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Mikrodalga fırın. MÜHENDİSLİK FAKÜLTESİ ARÇELİK MD574 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Plastik Limit Deney Seti MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM S225 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Prafin eritme Potası. MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM-C219 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Proktor Deney Seti MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM AS452/3 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Sabit Seviyeli permeabilite test seti. MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA YKM S223 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Saf su cihazı, 4 lt/Saat. Masaüstü veya duvara asılabilir MÜHENDİSLİK FAKÜLTESİ ŞİMŞEK SS-204 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Su banyosu, ortam sıcaklığı ile 90 C arasında 1 C hassasiyetle çalışır. MÜHENDİSLİK FAKÜLTESİ YÜKSEL KAYA MAKİNA YKM-S218/4 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Elektronik Terazi. 150 kg kapasiteli, 50 gr hassasiyetli MÜHENDİSLİK FAKÜLTESİ DENSİ DS150-50 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Hassas Terazı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Semra ÇORUH (362)312-1919 BAP
Nem Tayin Terazisi. 210 gr kapasiteli, 0.001 gr hassasiyetli MÜHENDİSLİK FAKÜLTESİ SHİMADZU MOC63U Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
PH METRE MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Semra ÇORUH (362)312-1919 BAP
Analitik Terazi. 510 gr kapasiteli 0.001 kapasiteli MÜHENDİSLİK FAKÜLTESİ RADWAG/PS510.RI Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Desktop Samsun Sağlık Yüksekokulu EXPER ACTION DEX223 İ7 4790 Doç.Dr. Aliye ÖZENOĞLU (362)312-1919 BAP
Hassas Terazi. 20000 gr kapasiteli 0.1 kapasiteli MÜHENDİSLİK FAKÜLTESİ RADWAG/WLC20/A2 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Hassas Terazi. 6000 gr kapasiteli 0.01 kapasiteli MÜHENDİSLİK FAKÜLTESİ RADWAG/PS6000.RI Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
monitör Samsun Sağlık Yüksekokulu PHİLİPS 21.5" Doç.Dr. Aliye ÖZENOĞLU (362)312-1919 BAP
Desktop Samsun Sağlık Yüksekokulu Doç.Dr. Aliye ÖZENOĞLU (362)312-1919 BAP
Digital Refraktometre Samsun Meslek Yüksekokulu ATAGO PAL-1 Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
PAR Sensörü Samsun Meslek Yüksekokulu APOGEE SQ-110 Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
PAR Sensörü ZİRAAT FAKÜLTESİ APOGEE SQ 110 Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
Sıcaklık-Nem Kaydedici ZİRAAT FAKÜLTESİ ONSET U12-013 Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
Vakum pompası Rocker 300. Kuru tip. Vakum ayarlanabilir, vakum göstergesi ve 3 metre hortumlu ile birlikte MÜHENDİSLİK FAKÜLTESİ LAB312/DRVAC 300 Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
monitör Samsun Sağlık Yüksekokulu Doç.Dr. Aliye ÖZENOĞLU (362)312-1919 BAP
Çalışma İstasyonlu Solar Simülatör AM 1.5G SOLAR SIMULATOR FEN EDEBİYAT FAKÜLTESİ OPTOSENSE SOLAR100 Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Bilgisayar Desktop HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ EXPER FLX DEX309 İ5 4590 Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Laptop Bilgisayar HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ACER NX-MVHEY-013 Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Nem/Sıcaklık/Mutlak basınç ölçüm cihazı + U probu MİMARLIK FAKÜLTESİ Dr.Öğr.Üyesi Erhan Burak PANCAR 4813 BAP
Termal Kamera MİMARLIK FAKÜLTESİ Dr.Öğr.Üyesi Erhan Burak PANCAR 4813 BAP
Oksijen bomba kalorimetre MÜHENDİSLİK FAKÜLTESİ DDSYSTEMS CAL2 ECO Dr.Öğr.Üyesi Selim CEYLAN (362)312-1919 BAP
EPPENDORF THERMOMIXER C ( PLATE VE PCR 96 SMARTBLOK KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ EPPENDORF THERMOMİKSER C Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
Masaüstü bilgisayar MÜHENDİSLİK FAKÜLTESİ EXPER FLEX DEX196 Doç.Dr. Erdal KILIÇ (312)191-9108 BAP
ÇEKER OCAK KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ MİKROTEST MCO-120 Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
Batarya İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Etüv (2 adet) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Hafıza kartı 64 İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Kamera Taşıma çantası İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Kompakt Elektret kondansatörlü mikrofon İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Sıcak Işık İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Tripod (Kamera Ayağı) İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Ultrasonik Banyo FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Yaka mikrofonu İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Cerrahi ünit DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Mehtap MUĞLALI (362)312-1919 BAP
Cerrahi ünit DİŞ HEKİMLİĞİ FAKÜLTESİ SİRONA Prof.Dr. Mehtap MUĞLALI (362)312-1919 BAP
Microsoft office Türkçe programı Samsun Sağlık Yüksekokulu Microsoft Office 365 Doç.Dr. Aliye ÖZENOĞLU (362)312-1919 BAP
Veri kaydedicisi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Erdem KOÇ (362)312-1919 BAP
Hassas Terazi ( MW223İ) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Isıtıcılı manyetik karıştırıcı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Potansiyostat - Galvanostat Sistemi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 0 362 312 1919 /1334 BAP
Analgesymeter TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
Bilgisayarlı Kayıt ve Analiz Sistemi TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
Buzdolabı Derin Donduruculu TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
Deney hayvanı kafesi TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
Motorlu Versoflo Kit Sistemi (Motorlu ve Hava beslemeli Sistem) TIP FAKÜLTESİ Prof.Dr. Ahmet Yilmaz ÇOBAN (362)312-1919 BAP
Ot biçme makinası ZİRAAT FAKÜLTESİ Prof.Dr. Zeki ACAR (362)312-1919 BAP
Sterotaksik cerrahi aleti TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
terazi ZİRAAT FAKÜLTESİ Prof.Dr. Zeki ACAR (362)312-1919 BAP
Çapa Makinası ZİRAAT FAKÜLTESİ Prof.Dr. Zeki ACAR (362)312-1919 BAP
Etüv (120 lt) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI (362)312-1919 BAP
Terazi (0,01 gr hassasiyetli) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI (362)312-1919 BAP
Ultrasonik Homojenizatör MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI (362)312-1919 BAP
CBR Deney Cihazı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Kefeli laboratuar terazisi (3g kapasiteli,0.01g hassasiyetli) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ (362)312-1919 BAP
Kesme Kutusu Deneyi Seti MÜHENDİSLİK FAKÜLTESİ ELE Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Konsolidasyon Deney Seti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Teraziler için Plaxiglass kabin MÜHENDİSLİK FAKÜLTESİ DOTEK Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Vakumlu İndüksiyon fırını (Quartz tüp ile beraber) MÜHENDİSLİK FAKÜLTESİ 15KW EQ-SP-15VIM Dr.Öğr.Üyesi Mevlüt GÜRBÜZ (362)312-1919 BAP
Üç Eksenli Deney Aleti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Bilgisayar monitorü TIP FAKÜLTESİ MC914TU Doç.Dr. Aydın HIM (362)312-1919 BAP
Fare ve Klavye TIP FAKÜLTESİ MLA22TU-MLA02TU Doç.Dr. Aydın HIM (362)312-1919 BAP
EPSON L850 YAZICI ZİRAAT FAKÜLTESİ HP B3Q11A COLOR LASERJET PRO MFP M277 DW Dr.Öğr.Üyesi Emine KAYA ALTOP (362)312-1919 BAP
Asetilen gaz tüpü ve regülatürü MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 0 362 312 1919 /1334 BAP
Yüzey sıcaklık ölçer MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN (362)312-1919 BAP
Duvar Kayma Deney Seti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
EL ÇAPA MOTORU VE YEDEK BIÇAK TAKIMI ZİRAAT FAKÜLTESİ Prof.Dr. Erkut PEKŞEN (542)676-7494 BAP
KLOROFİL ÖLÇÜM CİHAZI ZİRAAT FAKÜLTESİ Prof.Dr. Erkut PEKŞEN (542)676-7494 BAP
Sıcak baskı makinası ve Kalıp MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN (362)312-1919 BAP
X_IŞINI TÜPÜ KARADENİZ İLERİ ARAŞTIRMALAR MERKEZİ Prof.Dr. Hasan GÜMÜŞ (036)231-2191 BAP
23,6" Monitor s240390h İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Bilgisayar Desktop HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Gwalley Edius Pro 7 EDU İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Harici Harddisk İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Hidrotermal Sentez Cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
Hoparlör İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Kurgu Bilgisayarı İLETİŞİM FAKÜLTESİ Prof.Dr. M. Nurdan TAŞKIRAN 0362312 1919 BAP
Laptop Bilgisayar HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Laptop Bilgisayar HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
PCR KABİNİ FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Arif GÖNÜLOL (362)312-1919 BAP
Zemin Elek Seti MÜHENDİSLİK FAKÜLTESİ CISA Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Dijital mikrometre ZİRAAT FAKÜLTESİ LYK 5202 DİJ. MİK MET CİH Dr.Öğr.Üyesi Umut Sami YAMAK (362)312-1919 BAP
İnkübatör-soğutmalı ZİRAAT FAKÜLTESİ Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Endoskopi US TIP FAKÜLTESİ FUJİNON Dr.Öğr.Üyesi İbrahim GÖREN (312)191-9213 BAP
Full HD Endovizyon görüntüleme sistemi TIP FAKÜLTESİ RICHARD WOLF Dr.Öğr.Üyesi Kadir ÖNEM 3357 BAP
SPEKTRAL DOMAIN OCT TARAMALI DİJİTAL RETİNA ANJİOGRAFİ CİHAZI TIP FAKÜLTESİ HEIDELBERG ENGINEERING Marka, Spectralis HRA+OCT Multicolor Model Dr.Öğr.Üyesi Özlem Eşki YÜCEL (362)312-1919 BAP
Termal Vakum Kaplama Ünitesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ahmet BULUT (362)312-1919 BAP
ULTRASONİK VİDEOBRONKOSKOPİ CİHAZI TIP FAKÜLTESİ Prof.Dr. Nurhan KÖKSAL (362)312-1919 BAP
Bitki öğütücüsü (aktar tipi-25000r/min, çelik,elek açıklığı=50-300mesh ) ZİRAAT FAKÜLTESİ Doç.Dr. Ayhan HORUZ (362)312-1919 BAP
Laboratuvar Tipi Yağ Çikartma Presi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
Likit Limit için konik penetrometre. % sn devre kesicili, dijital göstergeli, 30 ve 60 derece konik iğne ve 6 adet penetrasyon kapları ile birlikte MÜHENDİSLİK FAKÜLTESİ EFORTEST Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
Mikrotom cihazı TIP FAKÜLTESİ LEİCA Doç.Dr. Yurdanur SÜLLÜ (362)312-1919 BAP
Hassas Terazi TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE (362)312-1919 BAP
Yoğun Bakım Ventilatör Cihazı TIP FAKÜLTESİ Prof.Dr. Levent ALTUNTOP (362)312-1919 BAP
Buzdolabı TIP FAKÜLTESİ ARÇELİK Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Hassas Terazi TIP FAKÜLTESİ RECİSAL Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Isıtıcı Soğutucu Bloğu TIP FAKÜLTESİ BİOER Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Kuru Hava Sterilizatörü TIP FAKÜLTESİ MİCRO Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Macfarland TIP FAKÜLTESİ BİASA Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Ph metre TIP FAKÜLTESİ İNSELETRA Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
Saf Su & Ultra Saf Su Sistemi TIP FAKÜLTESİ HUMAN Prof.Dr. Asuman BİRİNCİ (036)231-2191 BAP
ÇEKER OCAK MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
DSP Deney Seti Yazılım ve Lisansı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Erdal KILIÇ (312)191-9108 BAP
HPLC DEDEKTÖRÜ MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Talip KAHYAOĞLU (362)312-1919 BAP
bilgisayar ZİRAAT FAKÜLTESİ HP AIO 20 Dr.Öğr.Üyesi Yılmaz KAYA 1362 BAP
Diz üstü Bilgisayar İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Prof.Dr. Ebül Muhsin DOĞAN 6000 BAP
Masaüstü bilgisayar İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Prof.Dr. Ebül Muhsin DOĞAN 6000 BAP
Projeksiyon cihazı İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Prof.Dr. Ebül Muhsin DOĞAN 6000 BAP
Projeksiyon perdesi İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Prof.Dr. Ebül Muhsin DOĞAN 6000 BAP
Elektrokonvulsif Terapi Cihazı TIP FAKÜLTESİ Prof.Dr. Ömer BÖKE (362)312-1919 BAP
DERİN DONDURUCU FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Arif GÖNÜLOL (362)312-1919 BAP
DEIONIZE VE ULTRA SAF SU CİHAZI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ELGA OPTİON Q 7 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
ETÜV HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ JSR JSON 100 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
HASSAS TERAZİ (0,0001 GR HASSASİYET) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RADWAG AS 220.R.2 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
KABA TERAZİ (0,1 GR HASSASİYET) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RADWAG WLC 10/A 2 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
KURU ISITICI HOTPLATE HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ MTOPS HP630 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
KURU ÇALKALAYICI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İKA KS 260 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
PH METRE MASA TİPİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB 616.11.001 Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
SAF SU CİHAZI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ISOLAB Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
StatiCAD MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal HACIEFENDİOĞLU (362)312-1919 BAP
NO FROST BUZDOLABI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BOSCH KDN 56 AW32 N Prof.Dr. Aydın MISIRLIOĞLU 5113681 BAP
UPS HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Doç.Dr. İbrahim SÖNMEZ (362)312-1919 BAP
İş istasyonu HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Doç.Dr. İbrahim SÖNMEZ (362)312-1919 BAP
DSP Deney Seti Yazılım ve Lisansı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Erdal KILIÇ (312)191-9108 BAP
Deney Klavuzu MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Erdal KILIÇ (312)191-9108 BAP
USB Emülatör MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Erdal KILIÇ (312)191-9108 BAP
Görüntüleme Sistemi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Turan Kaya YAZICILAR (362)312-1919 BAP
Partikül Boyut Ölçüm Cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Kesintisiz Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Rotametre MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 0 362 312 1919 /1334 BAP
Analitik Hassas Terazi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Baca Gazı Analiz Cihazı ZİRAAT FAKÜLTESİ TESTO 340 Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Nem tayin cihazı ZİRAAT FAKÜLTESİ PCE -WTIN Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Terazi 0.1 gr ZİRAAT FAKÜLTESİ radwag Prof.Dr. Zeki ACAR (362)312-1919 BAP
Masaüstü bilgisayar (monitör + kasa) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan Kurt KIZILDOĞAN (362)312-1919 BAP
Compact Gel Documentation System TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
Mikrodalga Fırın TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
Analitik terazi (0,0001g hassasiyet) ZİRAAT FAKÜLTESİ RADWAG AS 220 R2 Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Kül fırını ZİRAAT FAKÜLTESİ PROTERM PLF 120/10 Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Burgu reaktör MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Selim CEYLAN (362)312-1919 BAP
AKIM TERAZİSİ DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
ATWOOD VE SERBEST DÜŞME DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
AÇISAL HIZ VE AÇISAL İVME DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
BASİT SARKAÇ DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
BURULMA DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Bilgisayar (Notebook) FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Davut YİĞİTPAŞA 03623121919 BAP
BİOT-SAVART KANUNU DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
DURAĞAN DALGALAR DENEY SETİ (VERİ TOPLAMACİHAZI DAHİL) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
ELASTİSİTE DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
EŞ POTANSİYEL VE ELEKTRİK ALAN ÇİZGİLERİ DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
HAVA RAYI DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
HAVA RAYI DENEY SETİ ( HAREKET KANUNLARI ) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
HELMHOLTZ BOBİNLERİ (VERİ TOPLAMACİHAZI DAHİL) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
KALDIRAÇ DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
KATILARIN VE SIVILARIN ÖZISILARININ BELİRLENMESİ DENEY SETİ (KALORİMETRE KABI ) HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
MANYETİK İNDÜKSİYON DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
MERKEZCİL KUVVET DENEY SETİ - VERNİER HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
TELDE REZONANS DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
TEMEL ELEKTRİK DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
TRANSFORMATÖR DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
WHEATSTONE KÖPRÜSÜ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ RENKO Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
YAYLAR DENEY SETİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
ÖLÇME VE HATALAR DENEY SETI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Pelet Sobası (Violet Kuru Soba) ZİRAAT FAKÜLTESİ Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Spektrofotometre cihazı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ HACH DR 6000 Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
ELEKTROMAGNETİK ALAN ÖLÇER FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
GAUSMETRE FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Mikrodalga Fırın FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
NEB.211E El tipi, harici detektörlü (DOZ HIZ ÖLÇER) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Hibridizasyon- denaturasyon cihazı TIP FAKÜLTESİ BRİGHT-SİDE Doç.Dr. Yurdanur SÜLLÜ (362)312-1919 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ HP 15-AY025NT Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ HP 15-AYO25NT Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
UV Laboratuvar Maskesi TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
ASKIDA KATI MADDE DÜZENEĞİ-VAKUM POMPASI MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
CNC freze MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 0 362 312 1919 /1334 BAP
EC Metre MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Fotometre MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Jar Test Cihazı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Termoreaktör MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Türbidimetre MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
pH Metre MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Çözünmüş oksijen ölçer MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
ısıtıcılı manyetik karıştırıcı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
Vakumlu Tüp Fırını MÜHENDİSLİK FAKÜLTESİ PROTHERM Dr.Öğr.Üyesi Mevlüt GÜRBÜZ (362)312-1919 BAP
Çizicili Yatar Ebatlama Makinesi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Asetilen tüpü MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
MORIA marka mevcut yapay önkamara ve EVO3E modeli kontrol ünitesi ile birlikte kullanılarak ve Tek kesi ile Ultra-Thin DSAEK yapmak için MORIA marka sistem TIP FAKÜLTESİ Dr.Öğr.Üyesi Ertuğrul CAN (362)312-1919 BAP
Elek sallama cihazı ve elek seti ZİRAAT FAKÜLTESİ NASA 1000 Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Fırın (Compact Vertical Split 2'' Quartz Tube Furnace with SS Vacuum Flanges) FEN EDEBİYAT FAKÜLTESİ PROTHERM Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
GPS El Terminali HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ NAVA Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
TAŞINABİLİR HARİCİ DİSK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ SEAGETE Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Atölye Çalışma Masası MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Marangoz Tezgahı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Tabure MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Çelik Raf MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
Yoğun Bakım 17 Adet Hasta Başı Monitörü+ 1 Adet Merkezi Monitör TIP FAKÜLTESİ Dr.Öğr.Üyesi Seher KIR 2896 BAP
KLOROFİL a ve CDOM ÖLÇER CİHAZI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ TURNER DESİGNS Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
SECCHI DİSK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
TURBIDIMETRE BULANIKLIK ÖLÇER HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ HACH 2100Q Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Taşınabilir Bilgisayar (2'si 1 Arada- Tablet+Notebook) EĞİTİM FAKÜLTESİ asus tp200sa-fv110ts Doç.Dr. İsmail GELEN (362)312-1919 BAP
Taşınabilir projeksiyon cihazı EĞİTİM FAKÜLTESİ lg ph300 Doç.Dr. İsmail GELEN (362)312-1919 BAP
ÇOKLU PARAMETRE ÖLÇÜM CİHAZI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ HACH LANGE Dr.Öğr.Üyesi Sema ARIMAN 3121919- 7282 BAP
Basınç ölçer cihazı ZİRAAT FAKÜLTESİ keller AG Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Buz Dolabı (Derin Donduruculu) ZİRAAT FAKÜLTESİ altus al 370 ey Doç.Dr. Ünal KILIÇ (362)312-1919 BAP
Damar Görüntüleyici Cihaz TIP FAKÜLTESİ Prof.Dr. Ayhan DAĞDEMİR (362)312-1919 BAP
Göz Ameliyat Mikroskobu ve Geniş Açı Görüntüleme Sistemi TIP FAKÜLTESİ Dr.Öğr.Üyesi Hilal ESER ÖZTÜRK (362)3121919 BAP
Laser Doppler Flowmetry TIP FAKÜLTESİ Doç.Dr. Tekin ŞİMŞEK (362)312-1919 BAP
Pelet mekanik dayanım test düzeneği (güç ünitesi hariç) ZİRAAT FAKÜLTESİ Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Pelet/Briket mekanik dayanım test düzeneği (güç ünitesi hariç) ZİRAAT FAKÜLTESİ Doç.Dr. Gürkan Alp Kağan GÜRDİL (362)312-1919 BAP
Taşıyıcı Aparat TIP FAKÜLTESİ Prof.Dr. Ayhan DAĞDEMİR (362)312-1919 BAP
Transkranyal Manyetik Stimulator Cihazı 1-100 Hz Repetitive Stimulator Sistemi Single ve Repetitive Pulse TIP FAKÜLTESİ Prof.Dr. Hacer Erdem TİLKİ (362)312-1919 BAP
24V NEMA 23 TEK ŞAFT ÇIKLIŞLI STEP MOTOR VE MOTOR SÜRÜCÜ DEVRESİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
24V NEMA 23 ÇİFT ŞAFT ÇIKIŞLI STEP MOTOR VE MOTOR SÜRÜCÜ DEVRESİ HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
8mm ÇAPINDA KROM MİL 2 metre HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
ALÜMİNYUM YAPRAK MENTEŞE HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
Ana iniş takımı jant ve fren seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ 57-1 / 57-1A Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
BAĞLANTI ÇATALI HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
Burun iniş takımı jant seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ 59-2A Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
Fırın MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Fahri BİRİNCİ (362)312-1919 BAP
GE 08 UK 8X16X8-5 Dana Gözü Rulman HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
GE 6 PW 6X16X9-6,75 Dana Gözü Rulman HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
GE 8 PW 8X19X12-9 Dana Gözü Rulman HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
GE20 DANA GÖZÜ RULMAN HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
IGUS ESTM-GT25-GT POLİMER YATAK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
KAPLİN HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
KARDAN MAFSAL HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M12 VİDALI MİL HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M12 VİDALI MİL SOMUNU HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M20 KİLİTLİ SOMUN HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M20 PUL HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M20 VİDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M6 PUL HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M6 TAÇLI SOMUN HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M6 VİDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M8 PUL HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M8 TAÇLI SOMUN HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
M8 VİDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
NOS 6 MAFSAL KAFA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
Programlanabilir dip coater FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
SFK 01202 SAĞ DİŞ VİDALI MİL + SAĞ DİŞ SOMUN SET HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
SFK 01202 SOL DİŞ VİDALI MİL + SOL DİŞ SOMUN SET HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
SUCFL 201 PLASTİK YATAK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
ÜÇ ÇIKIŞLI REDÜKTÖR HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Aydemir Güralp URAL (362)312-1919 BAP
Sıvama presi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal YILDIZLI (036)312-1919 BAP
İ-5 veya üstü Pentium işlemcili bilgisayar ZİRAAT FAKÜLTESİ ASUS A6421-TR561D Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
TELEVİZYON ZİRAAT FAKÜLTESİ VESTEL 4K SMART 49UB 8300 Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Hot Plate ZİRAAT FAKÜLTESİ DAİHAN MARKA Prof.Dr. Ahmet KORKMAZ (362)312-1919 BAP
phmetre ZİRAAT FAKÜLTESİ TESTO 205 Dr.Öğr.Üyesi Umut Sami YAMAK (362)312-1919 BAP
Kapı numaraları FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Tekli kapı isimlik (6X20 cm) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Tekli kapı isimlik (6X25 cm) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Zincirli isimlik FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
ikili kapı isimlik FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
üçlü kapı isimlik FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Portatif emisyon ölçer (CH4, CO2, NH3, O2) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Nurdan Gamze TURAN (362)312-1919 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ HP Y0A49EA 1ay024nti5 Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
İ-5 veya üstü Pentium işlemcili bilgisayar ZİRAAT FAKÜLTESİ HP Pro one 400 62 20 Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
A First Course in Differential Geometry Yazar: Chuan- Chic Hsiung FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
An Introduction to Differential Geometry with Applications to Elasticity Yazar: Philippe G. Ciarlet FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
An Introduction to Riemannian Geometry with Applications to Mechanics and Relativity Yazarlar: Leonor Godinho, Jose Natario FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Applied Differential Geometry Yazar: William L. Burke FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Conformal Differential Geometry and Its Generalizations Yazarlar: Maks A. Akivis, Vladislav V. Goldberg FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Differential Geometry Yazar: Erwin Kreyszig FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Differential Geometry and Lie Groups for Physicists Yazar: Marian Fecko FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Differential Geometry and its Applications Yazar: John Oprea FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Elementary Differential Geometry Yazar: Andrew Pressley FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Elementary Differential Geometry Yazar: Barrett O'neill FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Elementary Differential Geometry Yazar: Christian Bar FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Introduction to Differential Geometry Yazarlar: Krishna S. Amur, D. J. Shetty, C. S. Bagewadi FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Manifolds and Differential Geometry Yazar: Jeffrey M. Lee FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Theoretical Kinematics Yazarlar: Oene Bottema, Bernard Roth FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
Topics in Differential Geometry Yazar: Peter W. Michor FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Ayhan TUTAR (036)231-2191 BAP
kesici delici motor TIP FAKÜLTESİ Prof.Dr. Nevzat DABAK 05322832748 BAP
Mikrodalga Fırın TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
The Cell: A Molecular Approach, Seventh Edition 7th Edition TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
Thompson & Thompson Genetics in Medicine, 8e (Thompson and Thompson Genetics in Medicine) 8th Edition TIP FAKÜLTESİ Dr.Öğr.Üyesi Abdülkadir BAKAY (530)826-5868 BAP
Liyofilizatör MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
kuluçka sıcaklık nem kontrolörü ZİRAAT FAKÜLTESİ ÇİMUKA Dr.Öğr.Üyesi Umut Sami YAMAK (362)312-1919 BAP
yumurta saklama kabini ZİRAAT FAKÜLTESİ ÇİMUKA Dr.Öğr.Üyesi Umut Sami YAMAK (362)312-1919 BAP
İNFRARED SICAKLIK ÖLÇER ZİRAAT FAKÜLTESİ TFA DOSTMANN Prof.Dr. Erkut PEKŞEN (542)676-7494 BAP
C kollu skopi TIP FAKÜLTESİ Siemens Cios Select Prof.Dr. Nevzat DABAK 05322832748 BAP
Cat-6 patch cord HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
KVM Switch, ekran klavye ve monitör HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
Kabinet HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
Network Switch HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
Server HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
Ses üstü rüzgar tüneli HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
UPS HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
İş istasyonu HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Ozan Mert GÖKTÜRK 03623121919-7698 BAP
Bal dinlendirme tankı ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet GÜLER (362)312-1919 BAP
Balmumu eritme kazanı ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet GÜLER (362)312-1919 BAP
Kornea Cross-Linking cihazı TIP FAKÜLTESİ Dr.Öğr.Üyesi Ertuğrul CAN (362)312-1919 BAP
Bilgisayar EĞİTİM FAKÜLTESİ Doç.Dr. Hanife SARAÇOĞLU (362)312-1919 BAP
Tüm vücuda UVA ve darband UVB verebilen Ultraviyole kabini TIP FAKÜLTESİ Prof.Dr. Mehmet Tayyar CANTÜRK 3121919-2471 BAP
Fitmate Bazal Metabolizma Hızı test Sistemi 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Holtain Scinfold Kaliper 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Holtain İnfantometre 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
T-SCAN PLUS 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
Vücut kompozitorü 19 Mayıs Samsun Devlet Konservatuvarı Öğr.Gör. Canan Asal ULUS 03624576089 BAP
13.3", Intel core i5, 1.39 gr., 5200U işlemcili Ultrabook EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS (362)312-1919 BAP
A4 4800 x 4800 dpi çözünürlüğünde Flatbed Tarayıcı EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS (362)312-1919 BAP
Pulse Sinyal Dönüştürücü Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
Sinyal Çevirici-Universal Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
TERMOKAPL (J,K,P,T) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
TERMOKAPL (J,K,P,T) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
Türbin Tip Minyatür Akışölçer Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
USB Veri Toplayıcı (Akım için) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
USB Veri Toplayıcı (Gerilim için) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
USB Veri Toplayıcı (Sıcaklık için) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ (362)260-5170 BAP
HD Video Kamera EĞİTİM FAKÜLTESİ Prof.Dr. Seher Balci ÇELİK (362)312-1919 BAP
Harici Hard disk 2 TB İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Selahattin KAYNAK (362)457-6917 BAP
Sony ICDPX440.CE7 USB''li Digital Ses Kayıt Cihazı Samsun Sağlık Yüksekokulu Doç.Dr. Zeliha KOÇ (362)457-6020 BAP
Hand Crimper MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
Ultrasonik Su Banyosu (6 L)14.500,00 MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON (362)312-1919 BAP
0.01 g'a duyarlı terazi ZİRAAT FAKÜLTESİ OHAUS PA4102C Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Fide yetiştirme tezgahı (90 * 160 cm boyutlarında krom malzeme) ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Harici disk - Western Digital My Book 3.5" 4TB WDBFJK0040HBK-EESN EĞİTİM FAKÜLTESİ Prof.Dr. Murat TAŞ 3121919-5898 BAP
Sera tipi inverter klima (24.000 btu soğutma kapasiteli) ZİRAAT FAKÜLTESİ regal marka Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
İklim Ünitesi ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Ameliyat mikroskobu TIP FAKÜLTESİ CARL ZEISS MARKA OPMI VARIO-700 MODEL Dr.Öğr.Üyesi Murat Sinan ENGİN (362)312-1919 BAP
Yüksek Geçerlilikli Doğum Simülatörü Eğitim Seti Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY (362)312-1919 BAP
OPTİKSEL KARAKTERİZASYON SİSTEMİ FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR (362)312-1919 BAP
Yüksek Performanslı Sıvı Kromatografi Cihazı (HPLC) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL (362)312-1919 BAP
biplan digital substraction anjiografi cihazı TIP FAKÜLTESİ Dr.Öğr.Üyesi Ayşegül İDİL SOYLU 362 3121919 2055 BAP
Eyemag Pro F DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 03626121919 BAP
Eyemag ışık kaynağı DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 03626121919 BAP
Açık devre rüzgar tüneli HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Euromi SP-6 Infrasonik Liposuction cihazı TIP FAKÜLTESİ Dr.Öğr.Üyesi İsmail KÜÇÜKER (362)312-1919 BAP
Radlanski frezi DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Selma Türkan ELEKDAĞ-TÜRK (362)312-1919 BAP
Sushi Söküm pensi DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Selma Türkan ELEKDAĞ-TÜRK (362)312-1919 BAP
Kesintisiz güç kaynağı, UPS tamiri veya yeni alımı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. A. Nur ONAR (362)312-1919 BAP
Diz üstü Bilgisayar YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Özgür BOSTANCI (054)269-3631 BAP
Elek sallama makinası FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ (362)312-1919 BAP
Elek seti (göz açıklığı; 0,125mm, 0,063 mm, 0,044mm, 0,025mm) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ (362)312-1919 BAP
GPS Cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ (362)312-1919 BAP
Su altı kamerası FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ (362)312-1919 BAP
Çoklu parametre ölçüm cihazı (Tuzluluk, İletkenlik, Sıcaklık, pH, Çözünmüş oksijen) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ (362)312-1919 BAP
SpectroShade Spektrofotometre DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi Emel KARAMAN (362)312-1919 BAP
Fakoemülsifikasyon cihazı TIP FAKÜLTESİ Dr.Öğr.Üyesi Hilal ESER ÖZTÜRK (362)3121919 BAP
PEDİATRİK FLEXİBLE ENTÜBASYON VİDEO ENDOSKOP TIP FAKÜLTESİ Prof.Dr. Ali Haydar ŞAHİNOĞLU (362)312-1919 BAP
YETİŞKİN FLEXİBLE ENTÜBASYON VİDEO ENDOSKOP TIP FAKÜLTESİ Prof.Dr. Ali Haydar ŞAHİNOĞLU (362)312-1919 BAP
Sıcaklık ve nem kaydedici cihaz ZİRAAT FAKÜLTESİ Prof.Dr. Musa SARICA (362)312-1919 BAP
Sıcaklık-Nem Kaydedici (Data logger) ZİRAAT FAKÜLTESİ Doç.Dr. Umut Sami YAMAK (362)312-1919 BAP
Sıcaklık-Nem Kaydedici (Data logger) usb arayüzü ZİRAAT FAKÜLTESİ Doç.Dr. Umut Sami YAMAK (362)312-1919 BAP
tezgah seviyesi buzdolabı ZİRAAT FAKÜLTESİ ALTUS AL- 305 Doç.Dr. Umut Sami YAMAK (362)312-1919 BAP
Ansys Academic Research EM MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Okan ÖZGÖNENEL (362)312-1919 BAP
CO2 inkübatörü (Multigaz) ZİRAAT FAKÜLTESİ PANASONİC MCO-5M (UV) Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN (362)312-1919 BAP
Distile Su Cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Arif GÖNÜLOL (362)312-1919 BAP
Hassas Terazi VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI (362)312-1919 BAP
Termostatlı kuru blok ısıtıcısı VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI (362)312-1919 BAP
Dijital fotoğraf makinası FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Davut KAPLAN (362)312-1919 BAP
Mause FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Davut KAPLAN (362)312-1919 BAP
Model üretim Sistemi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ARGES LK-129 Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Ayarlı Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Dijital Multimetre MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Dijital Ossiloskop MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Fonksiyon Jeneratörü MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Komple Arduino Eğitim Seti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Kıl Testere Makinası MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
MASA TİPİ PH METRE VETERİNER FAKÜLTESİ Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
Mini Taşlama Cihazı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
Taşınabilir Atölye MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
VORTEKS VETERİNER FAKÜLTESİ Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
mikro santrifüj (15.000 rpm) VETERİNER FAKÜLTESİ Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
Şarjlı Matkap MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ (362)312-1919 BAP
NI USB-6211 Bus-Powered M Series Multifunction DAQ Device, NI-DAQmx driver software and Signal Express LE for Windows MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Okan ÖZGÖNENEL (362)312-1919 BAP
1 Terabyte Taşınabilir Harddisk EĞİTİM FAKÜLTESİ Dr.Öğr.Üyesi Yaşar BARUT (362)312-1919 BAP
kuluçka makinesi ZİRAAT FAKÜLTESİ ÇİMUKA MARKA Doç.Dr. Umut Sami YAMAK (362)312-1919 BAP
Depo Konteyner (2 odalı) ZİRAAT FAKÜLTESİ Prof.Dr. Ahmet BALKAYA (312)191-9138 BAP
Otomatik PİPET 500-5000 µL (0.5- 5 mL) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT (362)312-1919 BAP
NVIVO 10 paket programı ZİRAAT FAKÜLTESİ Prof.Dr. Kürşat DEMIRYÜREK (362)312-1919 BAP
Mikrodalga Fırın BAFRA MESLEK YÜKSEK OKULU Prof.Dr. Ali Kemal AYAN (362)542-6760 BAP
Ultrasonik Banyo BAFRA MESLEK YÜKSEK OKULU Prof.Dr. Ali Kemal AYAN (362)542-6760 BAP
Yağış Ölçer BAFRA MESLEK YÜKSEK OKULU Prof.Dr. Ali Kemal AYAN (362)542-6760 BAP
Ultrasonik su banyosu 4L VETERİNER FAKÜLTESİ Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
EKG Holter YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Yıldırım KAYACAN (505)608-0344 BAP
Bilgisayar Desktop (i7 işlemci, 8GB RAM, 1 TB HDD, Paylaşımsız Ekran Kartı) Vezirköprü Meslek Yüksekokulu Dr.Öğr.Üyesi Gonca Özdemir TARI (362)647-0246 BAP
digital kumpas TIP FAKÜLTESİ Prof.Dr. Ahmet UZUN (036)231-2191 BAP
İnsansız Hava Aracı(İHA) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Metin YAVUZ (362)312-1919 BAP
DIAGNODENT PEN DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Emel KARAMAN (362)312-1919 BAP
Fotokopi Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ (362)457-6020 BAP
glossmetre DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Murat YENİSEY (362)312-1919 BAP
Aile planlaması maketi Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY (362)312-1919 BAP
embriyo ve fetüs gelişim süreci modeli Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY (362)312-1919 BAP
kadın pelvis kesit modeli Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY (362)312-1919 BAP
Dijital Kumpas ZİRAAT FAKÜLTESİ dosqua 2110-150mm Prof.Dr. Zeki ACAR (362)312-1919 BAP
Portatif pH metre VETERİNER FAKÜLTESİ Doç.Dr. Filiz AKDAĞ (362)312-1919 BAP
Monopot (Kamera ve fotoğraf makinesi ayağı) REKTÖRLÜK Doç.Dr. Onur BEKİROĞLU (362)312-1919 BAP
10 Ton Römork 4 Tekerlek ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL (362)312-1919 BAP
Silaj Makinesi ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL (362)312-1919 BAP
Tesviye Küreği ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL (362)312-1919 BAP
SOĞUTMALI İNKÜBATÖR ZİRAAT FAKÜLTESİ MEMMERT Doç.Dr. İsmail ERPER (362)312-1919 BAP
pH metre (masaüstü) ZİRAAT FAKÜLTESİ HANNA Doç.Dr. İsmail ERPER (362)312-1919 BAP
Dikey Elektroforez ZİRAAT FAKÜLTESİ BİO-RAD Doç.Dr. Hasan Murat AKSOY (312)191-9134 BAP
Davlumbaz HAVZA MESLEK YÜKSEK OKULU 390x140x50 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kuzine LPG'li HAVZA MESLEK YÜKSEK OKULU 100x100x85 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Silaj Paketleme Sistemi ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL (362)312-1919 BAP
ayaklı altı dolaplı dörtlü ocak HAVZA MESLEK YÜKSEK OKULU 100x100x85 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
dolaplı ara raflı çalışma tezgahı HAVZA MESLEK YÜKSEK OKULU 190x60x85 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
dolaplı ön arka sürgü kapaklı çalışma tezgahı HAVZA MESLEK YÜKSEK OKULU 150x100x85 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
duvar dolabı HAVZA MESLEK YÜKSEK OKULU 190x60x160 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
istif rafı dört sıra HAVZA MESLEK YÜKSEK OKULU 190x40x60 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
kazan yıkama HAVZA MESLEK YÜKSEK OKULU 120x70x57/9 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
sıyırma hunili çift evyeli taban raflı tezgah HAVZA MESLEK YÜKSEK OKULU 190x60x85 Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Akış Görselleştirme modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Bernoulli denklemi doğrulama modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Dairesel kesitlerde burulma deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Dijital gerinim ölçer HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Dijital kuvvet ölçer HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Diyaframda gerilim ve uzama deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Dönen kiriş yorulması test sistemi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Farklı Modüllerin takılabilmesi için Hava Akış Tezgahları ve Manometreler HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Germe çubuğunda flambaj deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kanat profili etrafında basınç ölçüm modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kiriş bükülme gerilmesi deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kiriş defleksiyonu deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kirişte bükülme momenti deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kirişte kesme kuvveti deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Kirişte plastik bükülme deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Mekanik testler için metal kiriş HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Otomatik veri toplama birimi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Potansiyel akış deney düzeneği ve su tankı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
SERTLİK ÖLÇER CİHAZI ADAPTÖR VE UÇLARI İLE BİRLİKTE AGROSTA MARKA ZİRAAT FAKÜLTESİ PCE PTR200 Prof.Dr. Hüseyin ÇELİK (362)312-1919 BAP
Sürükleme kuvveti hesaplama modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Sınır Tabaka analiz modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Test aleti alt tezgahı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Türbülanslı Jet akışı uygulama modülü HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Uzama ölçer eğitim seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Çok yönlü veri toplama sistemi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
İnce silindir deney seti HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET (505)602-0386 BAP
Veri Depolama Ünitesi TIP FAKÜLTESİ Doç.Dr. Tekin ŞİMŞEK (362)312-1919 BAP
Vakum manifoldu MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL (362)312-1919 BAP
uv lamba reaktörü MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Hanife BÜYÜKGÜNGÖR (362)312-1919 BAP
Esaote Marka MyLab Five Model Renkli Doppler Ultrasonografi cihazı ile tam uyumlu Kardiyo Upgrade Modülü; PA240 Model Eko Probu ile birlikte VETERİNER FAKÜLTESİ Doç.Dr. Yücel MERAL (362)312-1919 BAP
ALTTAN VE ÜSTTEN AYDINLATMALI MİKROSKOP FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT (362)312-1919 BAP
Lokal Emiş Kolu MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
BUZDOLABI VETERİNER FAKÜLTESİ BOSCH Doç.Dr. Gülay ÇİFTCİ (362)312-1919 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ HP250 G6 2EW06ES İ5 7200U-8G 256GB SSD 2GB AMD 520 VGA 15,6" W10 Prof.Dr. Hüsnü DEMİRSOY (362)312-1919 BAP
Elektrikli su motoru Samsun Meslek Yüksekokulu Dr.Öğr.Üyesi Bülent KÖSE (362)312-1919 BAP
GPS'li Nabız Monitörü YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU (362)312-1919 BAP
Laktat Analizörü YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU (362)312-1919 BAP
2 TB Hard Disk (Harici Bellek) EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Ahşap saplı hamur kesici HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Açacak HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Blender HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Buz kovası HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Dekor bıçağı set HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Düz spatula HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Ekmek bıçağı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Elektrikli cezve HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Elektrolit Cihazı VETERİNER FAKÜLTESİ Doç.Dr. Yücel MERAL (362)312-1919 BAP
Esaote Marka MyLab Five Model Renkli Doppler Ultrasonografi cihazı ile tam uyumlu Kardiyo Upgrade Modülü; PA240 Model Eko Probu ile birlikte VETERİNER FAKÜLTESİ Doç.Dr. Yücel MERAL (362)312-1919 BAP
Et bıçağı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kamera EĞİTİM FAKÜLTESİ Doç.Dr. Munise Handan GÜNEŞ (362)312-1919 BAP
Kapaklı paslanmaz çelik tencere HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kek kalıbı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kepçe HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kesme blokları HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Konserve Açacağı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Küver kabı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Kızartma maşası HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Masat HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Mayonez tenceresi HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Mikser HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Pasta dilimleyici 8 ve 12 porsiyon HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Pasta maşası HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Patates ezici HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Pedallı çöp kovası HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Plastik kazıyıcı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Polietilen kütük HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Rende büyük HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Rende küçük HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Sebze soyacağı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Servis kaşığı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Set üstü ızgara elektrikli HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Silikon eldiven HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Standart küvet HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Süzgeç çelik HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Tel kevgir HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Tel süzgeç HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Wok tava HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
elektrikli termosifon HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
fritöz HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
krema torbası HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
krep tava HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
kumaş peçete (45X45) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
kurabiye kesici HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
restaurant masa örtüsü (140X140) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
restaurant masa örtüsü (140X185) HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
restaurant masa örtüsü kapağı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
tek saplı tava HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Çok amaçlı bıçak HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Çok amaçlı maşa HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Çırpma teli HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Ölçü kaşığı HAVZA MESLEK YÜKSEK OKULU Dr.Öğr.Üyesi Ercan TURAL (362)714-5555 BAP
Blender Seti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ (362)312-1919 BAP
Metrovision marka MonPack Oküler Elektrofizyoloji Cihazı ile uyumlu multifokal ERG testi TIP FAKÜLTESİ Prof.Dr. İnci GÜNGÖR (362)312-1919 BAP
Veteriner Doppler Tansiyon Cihazı VETERİNER FAKÜLTESİ Doç.Dr. Yücel MERAL (362)312-1919 BAP
Veteriner Holter Cihazı VETERİNER FAKÜLTESİ Doç.Dr. Yücel MERAL (362)312-1919 BAP
Distile Su Cihazı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK (362)312-1919 BAP
ısıtıcılı manyetik karıştırıcı ZİRAAT FAKÜLTESİ WEİGHTLAB WF-MIA 1 Doç.Dr. Mehmet Ali ŞEVİK (362)312-1919 BAP
Binoküler stereozoom mikroskop ZİRAAT FAKÜLTESİ Prof.Dr. İzzet AKÇA 3623121919 BAP
Binoküler stereozoom mikroskop ZİRAAT FAKÜLTESİ soif st6024-b4 Prof.Dr. İzzet AKÇA 3623121919 BAP
Portatif pH metre MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Bahtiyar ÖZTÜRK 3623121919 BAP
Sıcaklık kontrol birimi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 3623121919 BAP
-20°C Derin dondurucu VETERİNER FAKÜLTESİ Prof.Dr. Zafer YAZICI BAP
Rüzgar Tüneli Ölçüm ve Görüntüleme Sistemi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Vilber Lourmat Jel Görüntüleme Sistemi Kamerası Alımı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Ahmet Hilmi ÇON 3623121919 BAP
Diz üstü bilgisayar 15/18gb/1Tb/15.6''/2GbVga FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
HP LAZERJET PRO PLL02 YAZlCI FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Elementel Analiz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Halil KÜTÜK 3623121919 BAP
Dondurucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT 3623121919 BAP
Hassas terazi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT 3623121919 BAP
Terazi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT 3623121919 BAP
tanklı yazıcı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Birsen Sağır DUYAR 3623121919 BAP
Deuterium lamp, CE detector FEN EDEBİYAT FAKÜLTESİ Prof.Dr. A. Nur ONAR 3623121919 BAP
Aparat Bağlantı aparatı/adaptörü tasarımı ve yapımı. FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Metin YAVUZ 3623121919 BAP
Akü bomesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Akü test cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Akü şarj cihazı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Akülü Vidalama FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Antifiriz bomesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Arabalı Zemin Kriko FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Atölye Tipi Hidrolik Pres FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Avuç Taşlama (900 W) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Ceraskal FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Darbeli matkap FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Demirci işkencesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Digital Kumpas FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Dijital Multimetre Avometre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Dijital mikrometre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Eğe takımı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Fosforlu duba FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Hareket Aktarım Elemanları ve Mekanizmalar Eğitim Seti FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Havalı Somun Sıkma (Seti ile birlikte) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Hidrolik Pnömatik Bağlantı Elemanları Eğitim Seti FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Hidrolik Sızdırmazlık Elemanları ve Silindir Sökme Takma Eğitim Seti FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Kaynak Makinesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Kaynak Makinesi (taşınabilir) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Komparatör saati ve standı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Kompresör FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Lastik onarım aletleri FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Lehimleme Seti FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Lokma Anahtar Takımı (232 parça set) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Malzeme Dolabı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Mekanik Kumpas FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Mekanik Mikrometre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Mengene FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Motorcu aletleri FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Planya & Kalınlık Makinesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Takım Arabası FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Takım Çantası FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Taşlama Motoru FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Telsiz Seti FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Tork Anahtarı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Transpalet FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Çalışma tezgahı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Çekmeceli Takım Dolabı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
Üç ayaklı vinç FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
0.45 µm disk filtre (PVDF) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
ABTS-1gr MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Adi filtre kağıdı Filter-Lab FR101050 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Agaroz (100g) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Amberlite® XAD16N MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Amberlite® XAD7HP MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Antibiyotik diskleri (50 disk/ pk),(Poymixin B, Ampicillin, Bacitracin, Kanamycin, Streptomycin, Tetracycline, Erythromycin, Chloramphenicol, Gentamicin, Vancomycin, Penicillin G, Rifampicin, Novobiocin, Rifamycin, Neomycin) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Aseton (avrupa) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Asetonitril (HPLC) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Balon joje-şilifli-kapaklı altı düz (250 ml) Isolab 013.01.250 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Balon joje-şilifli-kapaklı-altı düz (100 ml) Isolab 013.01.100 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Balon joje-şilifli-kapaklı-altı düz (1000 ml) Isolab 013.01.901 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Balon joje-şilifli-kapaklıaltı düz (500 ml) Isolab 013.01.500 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Beher (1ooo ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beher (600 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beyaz uç (1000/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Büret pensleri (çelik) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Büret standı dikdörtgen ayak (150x 300 mm) cubukları (750 mm uzunluk 12 mm kalınlık) Galvaniz veya paslanmaz çelikten) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam Beher (100, 250, 500 mL 10' şer adet) Isolab 025.01.100/025.01.250/025.01.600 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam Huni - 100 mm Isolab 041.01.080 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam Huni - 40 mm Isolab 041.01.040 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam Huni - 60 mm Isolab 041.01.060 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam kolon MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Cam şişe mavi vida kapaklı - (100 ml) Isolab 061.01.500 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cam şişe mavi vida kapaklı - (250 ml) Isolab 061.01.250 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Cyanidin chloride ≥95% (HPLC)-1mg MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Eldiven (Medium) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Elementel Analiz MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Yıldıray TOPCU 3623121919 BAP
Elementel analiz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hümeyra PAŞAOĞLU 3623121919 BAP
Eppendorf tüp (2 mL, otoklavlanabilir, 1000/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Etil alkol (5 L) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Etil alkol (>%98.5 saflıkta; 2.5 L) MÜHENDİSLİK FAKÜLTESİ Tekkim %>99.5 Prof.Dr. Ahmet Hilmi ÇON 3623121919 BAP
Etil asetat, Avr MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Eğitim (Nitel Araştırma Yöntemleri Eğitimi) İLAHİYAT FAKÜLTESİ Prof.Dr. Erkan PERŞEMBE 3623121919 BAP
Falcon tüp (mavi kapaklı, 50 mL), 200 adet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Falkon tüpü 50 ml ve 15 mL kapaklı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Fikri Mülkiyet Hakları ve Lisanslama Hizmeti REKTÖRLÜK Prof.Dr. Ömer ANDAÇ 3623121919 BAP
Fikri Mülkiyet Hakları ve Lisanslama Hizmeti REKTÖRLÜK Prof.Dr. Ömer ANDAÇ 3623121919 BAP
Florocult VRBA agar, 500g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Genomik DNA izolasyon kiti (250 rxn) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Gliserol, analitik saflıkta, 1000 mL MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Grafen Oksit (Graphen Oxide) Çözeltisi (30 ml) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Grafen Oksit (Graphen Oxide) Çözeltisi (60 ml) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Gram boyama seti MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
HClO4 (HPLC grade, 2,5 L) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
HPLC için vial, septumlarıyla birlikte, 2 ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
HPLC vial, 200 adet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Isı Transfer Sıvısı Yeşilyurt Demir-Çelik Meslek Yüksekokulu Dr.Öğr.Üyesi Engin ÖZBAŞ 3622605170 BAP
Kartlı-Parolalı Kapı Giriş Sistemi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
Karyo Tüp (2 mL, vidalı kapaklı, 100/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Karyo Tüp Kutusu (100 kuyu, 2 mL) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Kesintisiz Güç Kaynağı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
Kesintisiz güç kaynağı (UPS) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
Kurutma Askısı, 72 Yuvalı, Sökülür/Takılır, Tutaçlı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
M17 Agar MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
MRS agar MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Manyetik alınganlık Ölçümü (25-300 K) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hümeyra PAŞAOĞLU 3623121919 BAP
Manyetik balık (30mm) -- (20mm)-( 50mm) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Mavi uç (1000/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Maya ekstraktı, 500 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Membran şırınga filtre 50'lik steril Sartorius SM17846ACK MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Hanife BÜYÜKGÜNGÖR 3623121919 BAP
Mezür (25,50,100,250,500mL 5' er adet, altıgen taban) Isolab 015.01.025/015.01.050/015.01.100/015.01.250/015.01.500 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Na2CO3, 250 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Na4P2O7 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Otomatik pipet takımı - 1 takım ve Pipet standı (Eppendorf (10-100 µl); (100-1000 µl); (2000-10000 µl)-1 er adet) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Otomatik pipet ucu (10-100 µl)--1000 adet/paket Isolab T-B-200 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Otomatik pipet ucu (100-1000 µl) --1000 adet/paket Isolab T-B-1000 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
PCR tüp (0,2 ml; 1000/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Pastör pipeti 3 ml plastik MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Pipet (1, 2, 5, 10, 25 mL 10' ar adet) Isolab 021.01.001/021.01.002/021.01.005/021.01.010/021.01.025 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Pipet Pompası (10 mL'ye kadar ve 25 mL ye kadar) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Piset 250 ml Isolab 062.05.250 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Piset 500 ml Isolab 062.05.500 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Plastik Huni - 100 mm Isolab 041.02.080 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Plastik Huni - 40 mm Isolab 041.02.040 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Plastik Huni - 60 mm Isolab 041.02.060 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Poli üretan reçine MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Polipropilen Mezür- Uzun form (25, 50, 100, 250, 500 mL) altıgen taban MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Primerler (58 bp) 1'er adet 5'-AGA GTT TGA TCM TGG CTC AG TA 5'-C CAG GGT ATC TAA TCC 5'-AAA CTC AAA GGA ATT GAC GG MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Ruthenium red, 1 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
STANTLAR - MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
STANTLAR - MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Santrifüj tüpü (50 mL) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
Sarı uç (1000/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Skim milk powder, 500 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Sodyum nitrit (NaNO2)-Merck MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Steril stomacher poşeti, 250 adet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Suya Dayanıklı Dijital Termometre -- ( -50 ve +300°C ) (Paslanmaz çelikten delici prob) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Sükroz, 1 kg MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Süt MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
TCA, 250 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
TGA MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Tablet bilgisayar EĞİTİM FAKÜLTESİ Doç.Dr. Celil NEBİYEV 3623121919 BAP
Teflon Santrifüj tüpü MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Tryptic Soy Broth, 500 g MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Tüp - cam - vidalı kapaklı - 16 cm x 160 mm (1 PAKET = 100 ADET) Isolab 077.03.002 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Tüp - cam - vidalı kapaklı -- 16 cm x 100 mm (1 PAKET = 100 ADET) Isolab 077.03.001 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Tüp Standı (50 mL Falkon Tüpler İçin)-Plastik-18 Delik-50 mL Isolab 079.03.005 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Whatman 42 (2.5 µm pore, 90 mm, 100/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Whatman No:1 (11µm pore, 90 mm, 100/pk) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Whatman-1 Filtre kağıdı 42.5 mm çapında Sigma WHA1541042 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
Wistar Albino Sıçan TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Workstation MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
potasyum persülfat-100gr MÜHENDİSLİK FAKÜLTESİ Doç.Dr. İlkay KOCA 3623121919 BAP
trimethoxy(octadecyl)silane MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 3623121919 BAP
Çok fonksiyonlu yazıcı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
İş istasyonu bilgisayar MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sedat AKLEYLEK 3623121919 BAP
Şirketleşme ve girişimcilik hizmeti REKTÖRLÜK Prof.Dr. Ömer ANDAÇ 3623121919 BAP
Şirketleşme ve girişimcilik hizmeti REKTÖRLÜK Prof.Dr. Ömer ANDAÇ 3623121919 BAP
Şırınga filtre (0.45 µm), 150 adet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Elementel analiz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hümeyra PAŞAOĞLU 3623121919 BAP
Manyetik alınganlık Ölçümü (25-300 K) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hümeyra PAŞAOĞLU 3623121919 BAP
Osmolarite YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Mehmet Yalçın TAŞMEKTEPLİGİL 3121919567 BAP
Sıçan (Wistar albino, erkek) TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
PMM 8053 cihazının kalibrasyonu MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Çetin KURNAZ 3623121919 BAP
96 kuyucuklu Plak düz tabanlı steril TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Alüminyum folyo (45 cm x 100 m 18 Mic) ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
Avadanlık Dolabı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
BACTEC MGIT 960 PZA Ortamı TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
BD BACTEC MGIT 960 PZA Kiti (50 testlik) TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Fosforik asit (500 ml moleküler saflıkta olacak) ZİRAAT FAKÜLTESİ SİGMA Prof.Dr. Mehmet KURAN 3624576086 BAP
Freze Tezgahı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Heat inactivated fetal calf serum (100ml) ZİRAAT FAKÜLTESİ N4762 Prof.Dr. Mehmet KURAN 3624576086 BAP
MS Besi Yeri 100lt ZİRAAT FAKÜLTESİ PHY TOTECLALOB Doç.Dr. Musa KAVAS 3623121919 BAP
MS besi yeri vitaminli 100lt ZİRAAT FAKÜLTESİ PHYTOTECHLOB M 519 Doç.Dr. Musa KAVAS 3623121919 BAP
Na sitrat(1 kg moleküler saflıkta olacak) ZİRAAT FAKÜLTESİ MERCK Prof.Dr. Mehmet KURAN 3624576086 BAP
PCR multiplate (96 kuyucuklu) 5 x 20 adet ZİRAAT FAKÜLTESİ New bioscience NB-P96 Dr.Öğr.Üyesi Levent MERCAN 3623121919 BAP
PCR tüpü TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Steril 50 ml'lik falkon tüp TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Steril filtreli Pipet ucu 1-10 μl TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Streç Film (45 cm x 150 m) ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
parafilm - 50 x 75 mm ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
pncA primer 200 nm HPLC, PF 5'GGCGTCATGGACCCTATATC3' ve PR 5'CAACAGTTCATCCCGGTTC3' TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
tube rack - with lid - double side ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - mikrosantrfüj - P.P - 0,5 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - santrfüj - P.P - vidalı kapaklı - 15 ml- DNA/RNA free - steril ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - santrfüj - P.P - vidalı kapaklı - 50 ml - DNA/RNA free - etekli - steril ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - santrfüj - P.P - vidalı kapaklı - 50 ml - DNA/RNA free - steril ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp cryo - 2,0 ml - etekli - steril 100 ad/pk ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp cryo - 5,0 ml - etekli - steril 100 ad/pk ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
şişe - borosilikat cam - şeffaf - vidalı kapaklı - 2000 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
şişe - borosilikat cam - şeffaf - vidalı kapaklı - 500 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
Elektro-Ultrafiltrasyon sistem MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
ACTH hormon kiti ZİRAAT FAKÜLTESİ CUSABIO Prof.Dr. Güray ERENER 3623121919 BAP
Campylobacter spp. Campy CVA agar ZİRAAT FAKÜLTESİ Himedia Prof.Dr. Güray ERENER 3623121919 BAP
Polystrene düztabanlı ELISA pleyti (TPP) ZİRAAT FAKÜLTESİ Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Laptop Bilgisayar ZİRAAT FAKÜLTESİ LENOVO V510 İ7-7500U Prof.Dr. Hüsnü DEMİRSOY 3623121919 BAP
Mavi LaserJet Toner Kartuşu CE311A (Orijinal) ZİRAAT FAKÜLTESİ Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Siyah LaserJet Toner Kartuşu CE310A (Orijinal) ZİRAAT FAKÜLTESİ Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
İ-5 veya üstü Pentium işlemcili bilgisayar ZİRAAT FAKÜLTESİ HP 25EA 7500T Prof.Dr. Hüsnü DEMİRSOY 3623121919 BAP
(−)-Glutathione, oxidized ZİRAAT FAKÜLTESİ acros Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
100 bp DNA Ladder ZİRAAT FAKÜLTESİ SOLİS BİO DYNE Doç.Dr. Musa KAVAS 3623121919 BAP
2-Thiobarbituric acid ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
20 ya da 25'lik Lam boyama sepeti 58,0020 adet1.160,00Preperatları alkol, ksilol ve boya serilerinden toplu olarak geçirmek için Sağlık Hizmetleri Meslek Yüksekokulu L290410 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
20 ya da 25'lik Lam boyama sepeti 58,0020 adet1.160,00Preperatları alkol, ksilol ve boya serilerinden toplu olarak geçirmek için Sağlık Hizmetleri Meslek Yüksekokulu L290410 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
64 GB USB Flash Bellek Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
A-4 kağıdı Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
A4 Kağıt Alımı (20 adet) A4 80 Gr/m² 500 Adt/Pk Fotokopi Kağıdı (5'li Pkt/Koli) İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Selahattin KAYNAK 3624576917 BAP
Albumin from bovine serum ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Amonyak ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Yusuf DEMİR BAP
Amonyum asetat ZİRAAT FAKÜLTESİ isolab Prof.Dr. Yusuf DEMİR BAP
Amonyum klorür ZİRAAT FAKÜLTESİ isolab Prof.Dr. Yusuf DEMİR BAP
Ancymidol ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Apple mosaic virus Reagent Set ZİRAAT FAKÜLTESİ bioreba Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Askorbik asit ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Buthanol ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Büyük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
CD-R Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Catechol ZİRAAT FAKÜLTESİ fisher Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Cucumber mosaic virus Reagent Set ZİRAAT FAKÜLTESİ BİOREBA Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
DVD Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Disposable mikrotom bıçağı 50'lik Sağlık Hizmetleri Meslek Yüksekokulu Facefath Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Disposable mikrotom bıçağı 50'lik Sağlık Hizmetleri Meslek Yüksekokulu Facefath Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
EDTA ZİRAAT FAKÜLTESİ sigma Prof.Dr. Yusuf DEMİR BAP
EDTA ZİRAAT FAKÜLTESİ sigma Prof.Dr. Yusuf DEMİR BAP
ENTELLAN (100ML) Sağlık Hizmetleri Meslek Yüksekokulu 107961 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
ENTELLAN (100ML) Sağlık Hizmetleri Meslek Yüksekokulu 107961 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Erichrome Black T indikatör ZİRAAT FAKÜLTESİ merck Prof.Dr. Yusuf DEMİR BAP
Erichrome Black T indikatör ZİRAAT FAKÜLTESİ merck Prof.Dr. Yusuf DEMİR BAP
Etanol absolute 10 lt ZİRAAT FAKÜLTESİ tekkim Prof.Dr. İlknur AYAN 3623121919 BAP
Ethanol ZİRAAT FAKÜLTESİ isolab Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Ethephon ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Falcon tüp 50 ML ZİRAAT FAKÜLTESİ isolab Prof.Dr. Yusuf DEMİR BAP
Falcon tüp 50 ML ZİRAAT FAKÜLTESİ isolab Prof.Dr. Yusuf DEMİR BAP
Ferric ammonium sulphate (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Ferric ammonium sulphate (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Flurprimidol ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Fotoğraf Makinesi (Sony Cyber Shot DSC-HX400V) BAFRA MESLEK YÜKSEK OKULU Prof.Dr. Cüneyt ÇIRAK 3623121919 BAP
GPS (Garmin Etrex 10) BAFRA MESLEK YÜKSEK OKULU Prof.Dr. Cüneyt ÇIRAK 3623121919 BAP
Glutathione Reductase from baker's yeast (S. cerevisiae) (100 UN) ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Guaiacol ZİRAAT FAKÜLTESİ acros Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Harris's alum hematoksilen 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 109253 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Harris's alum hematoksilen 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 109253 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Hematoksilen solüsyonu 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 105174 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Hematoksilen solüsyonu 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 105174 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Hidrojen peroksit (H2O2) ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Hydrochloric acid ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Kaba filtre kağıdı ZİRAAT FAKÜLTESİ Prof.Dr. Yusuf DEMİR BAP
Kaba filtre kağıdı ZİRAAT FAKÜLTESİ Prof.Dr. Yusuf DEMİR BAP
Kalem Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Kompresor HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ATLAS Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Küçük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Lam (50 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lam (50 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lam boyama kabı (20 ya da 25'lik kapaklı) 45,0060 adet2.700,00Lam üzerindeki dokuların deparafinizasyon, şeffaflaştrıma, boyama işlemlerinde kullanmak için, Sağlık Hizmetleri Meslek Yüksekokulu L290411 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lam boyama kabı (20 ya da 25'lik kapaklı) 45,0060 adet2.700,00Lam üzerindeki dokuların deparafinizasyon, şeffaflaştrıma, boyama işlemlerinde kullanmak için, Sağlık Hizmetleri Meslek Yüksekokulu L290411 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Magnezyum Klorür ZİRAAT FAKÜLTESİ merck Prof.Dr. Yusuf DEMİR BAP
Magnezyum Klorür ZİRAAT FAKÜLTESİ merck Prof.Dr. Yusuf DEMİR BAP
Metionin ZİRAAT FAKÜLTESİ sial Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Oksalik asit (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Oksalik asit (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Orta boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Paclobutrazol ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Phosphotungustic asit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Phosphotungustic asit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Pipet Ucu, Beyaz, 10-200 µl, 1000'lik Poşette 5 adet ZİRAAT FAKÜLTESİ isolab Prof.Dr. İlknur AYAN 3623121919 BAP
Pipet Ucu, Mavi, 100-1000 µl, 500'lük Poşette 10 adet ZİRAAT FAKÜLTESİ isolab Prof.Dr. İlknur AYAN 3623121919 BAP
Plastik eldiven (M) (Pudrasız) ZİRAAT FAKÜLTESİ Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Polyvinylpyrrolidone (PVP-40) (500 gr) ZİRAAT FAKÜLTESİ SİGMA Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Potassium phosphate dibasic ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Potassium phosphate monobasic ZİRAAT FAKÜLTESİ isolab Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Potasyum fosfat ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Primer sentezi (50nmol, HPLC saflıkta, 2.000 baz) ZİRAAT FAKÜLTESİ MACİOGEN Doç.Dr. Musa KAVAS 3623121919 BAP
Prunus necrotic ringspot virus Reagent Set ZİRAAT FAKÜLTESİ BIOREBA Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Riboflavin ZİRAAT FAKÜLTESİ alfaAesar Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
SOC Medium For use in transformation ZİRAAT FAKÜLTESİ bioshop Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
Sodium bicarbonate ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Sodium carbonate ZİRAAT FAKÜLTESİ tekim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Sodium hydroxide ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Sodyum fosfat ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Sodyum hegzametafosfat ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Yusuf DEMİR BAP
Sodyum hegzametafosfat ZİRAAT FAKÜLTESİ tekkim Prof.Dr. Yusuf DEMİR BAP
Steril Petri (9cm'lik) ZİRAAT FAKÜLTESİ Doç.Dr. Hasan Murat AKSOY 3121919134 BAP
Süzme sistemi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ isolab Dr.Öğr.Üyesi Sema ARIMAN BAP
TDZ (Thidiazuron) ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Telli dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Titreşimli zımpara HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BOSCH Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Trichloroacetic acid ZİRAAT FAKÜLTESİ isolab Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Tris(hydroxymethyl)aminomethane ZİRAAT FAKÜLTESİ merck Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Turnip mosaic virus Reagent set ZİRAAT FAKÜLTESİ BİOREBA Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Turnip yellow mosaic virus Reagent set ZİRAAT FAKÜLTESİ BİOREBA Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Turnip yellows virus (TuYV) complete kit ZİRAAT FAKÜLTESİ LOEWE Doç.Dr. Mehmet Ali ŞEVİK 3623121919 BAP
Uniconazole ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Vial Septum+Kapak (1,5 ml, cam, koyu renkli) ZİRAAT FAKÜLTESİ isolab Prof.Dr. Orhan KURT 3623121919 BAP
Xanthine ZİRAAT FAKÜLTESİ acros Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Xanthine Oxidase from bovine milk (5 UN) ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Yazıcı Toneri (1 adet) HP 85A 1600 Sayfa Kapasiteli Siyah Toner CE285A İKTİSADİ VE İDARİ BİLİMLER FAKÜLTESİ Doç.Dr. Selahattin KAYNAK 3624576917 BAP
beher - cam - kısa form - 100 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
beher - cam - kısa form - 400 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
beher - cam - kısa form - 600 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
enjektör 10 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
fotokopi Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
otomatik pipet ucu 10 ml lik 200 adet ZİRAAT FAKÜLTESİ isolab Prof.Dr. İlknur AYAN 3623121919 BAP
pipet - cam - 10 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
piset - P.E - dar boyun - 500 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tert-Butyl hydroperoxide solution ZİRAAT FAKÜLTESİ alfaaesar Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
tüp - mikrosantrfüj - P.P - 2,0 ml ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - mikrosantrfüj -P.P - 1,5 ml 500 ad / pk ZİRAAT FAKÜLTESİ NON STERİL Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - santrfüj - P.P - vidalı kapaklı - 15 ml 50 adet / paket ZİRAAT FAKÜLTESİ NON STERİL Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
tüp - santrfüj - P.P - vidalı kapaklı - 50ml 50 adet / paket ZİRAAT FAKÜLTESİ NON STERİL Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
İyot (100g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
İyot (100g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Şeffaf Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
şişe - borosilikat cam - şeffaf - vidalı kapaklı - 100 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
şişe - borosilikat cam - şeffaf - vidalı kapaklı - 1000 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
şişe - borosilikat cam - şeffaf - vidalı kapaklı - 250 ml ZİRAAT FAKÜLTESİ SH Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
β-Nicotinamide adenine dinucleotide hydrate (NAD+) (3x1G) ZİRAAT FAKÜLTESİ sigma Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Terazi (0.1 g ya da 1 g hassas 30 kg max kapasite) ZİRAAT FAKÜLTESİ DESİS RWP 30 Prof.Dr. Güray ERENER 3623121919 BAP
pH metre (et örnekleri ölçümü için katı problu) ZİRAAT FAKÜLTESİ TESTO 205 Prof.Dr. Güray ERENER 3623121919 BAP
2B dereceli tahta kurşun kalem EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
A4 Fotokopi Çekim Bedeli EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Beyaz torba zarf 300X400mm yapışkanlı veya silikonlu 110 gr 25 Li Paket EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Dust-Free sınav silgisi EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Magazinlik EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
80 gr A4 KAĞIDI Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Boş DVD ( 50 adet kutu ) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Flash bellek / 16 GB USB Flash Bellek Data Traveler Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Geniş klasör plastik A4 boy siyah Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Samsung SCX-4833FD yazıcı kartüşü Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Şeffaf dosya (100) lük Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
A4 Fotokopi Çekim Bedeli EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Büyük boy Lastik eldiven MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Büyük boy Lastik eldiven MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Büyük boy Lastik eldiven MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Gaz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Gaz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Gaz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Mini vana, 1/4 inç çapında MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Mini vana, 1/4 inç çapında MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Mini vana, 1/4 inç çapında MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Ph Metre (Portatif Ph, iletkenlik Olger) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Su filtresi motoru (Akvaryum tipi)-Su hızarı için MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Su filtresi motoru (Akvaryum tipi)-Su hızarı için MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Su filtresi motoru (Akvaryum tipi)-Su hızarı için MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Toz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Toz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Toz maskesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Endobronşial Ultrasonografi(EBUS)(komple sistem) TIP FAKÜLTESİ Prof.Dr. Meftun ÜNSAL 3623121919 BAP
Endovizyon sistemi ve debrider sistemi TIP FAKÜLTESİ Doç.Dr. Özgür KEMAL 5055025136 BAP
PE10 katater TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE 3623121919 BAP
PE20 katater TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE 3623121919 BAP
PE50 katater TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE 3623121919 BAP
Platin stimulatör TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE 3623121919 BAP
İzole doku valvi TIP FAKÜLTESİ Doç.Dr. S. Sırrı BİLGE 3623121919 BAP
0-10 µl mikropipet ucu FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
0-100 µl mikropipet ucu FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
100-1000 µl mikropipet uçları FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
ADİ FİLTRE KAĞIDI 250ADET/PKT HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ H2475040 Dr.Öğr.Üyesi Sema ARIMAN BAP
CAM MALZEME YIKAMA FIRÇASI 10MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
CAM MALZEME YIKAMA FIRÇASI 20MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
CAM MALZEME YIKAMA FIRÇASI 40MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
CAM MALZEME YIKAMA FIRÇASI 50MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
CAM MALZEME YIKAMA FIRÇASI 70MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
DAMLALIK 100ML CAM HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ C364014 Dr.Öğr.Üyesi Sema ARIMAN BAP
DENEY TÜPÜ 15ML PLASTİK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
DERECELİ PİPET 0.1ML HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ C201001 Dr.Öğr.Üyesi Sema ARIMAN BAP
DERECELİ PİPET 10ML HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
DERECELİ PİPET 1ML HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
DERECELİ PİPET 5ML HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Dithiothreitol redükte (DTTred) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Endüstriyel çalışma tezgahı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BODUR Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
G6P (Glukoz-6-fosfat) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Glutathion (GSH) (Sigma PHR1359) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Havya sehpası HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ MG-16129 Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Isı Tabancası HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BOSCH Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
KAPAKLI SERAMİK KROZE 40MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
KAPAKLI SERAMİK KROZE 60MM ÇAPINDA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Kaynak Makinesi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ ERSİM Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Kesme Tezgahı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ MAKİTA Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
L-Glutathion Oxidized (GSSG) (Sigma G4376) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Lehim istasyonu HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ SUNLİNE Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
MEMBRAN 0.45 MICRON GÖZENEKLİ FİLTRE HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Mezür 500ml HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
NADP (Nikotinamid adenin dinükleotit fosfat) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Parafilm ISOLAB 058.01.002 FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Plastik spektrofotometre küveti (1 ml) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
PİSET 500ML PLASTİK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
SERAMİK HAVAN 100MM HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BRAND Dr.Öğr.Üyesi Sema ARIMAN BAP
SPATÜL KAŞIK VE DÜZ ŞEKİLLERDE HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Sac kesme makinesi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal YILDIZLI BAP
Sodyum tetrationat (Sigma S5758) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
TAHTA MAŞA HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Taşlama Makinesi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ BOSCH Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Tezgah Mengenesi HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ MANNESMAN Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
TÜPLÜK HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Sema ARIMAN BAP
Üç boyutlu Yazıcı HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ MANKATİ Dr.Öğr.Üyesi Gökhan AHMET 5056020386 BAP
Aliminyum amonyum sülfat Sağlık Hizmetleri Meslek Yüksekokulu Merck-101031 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Alüminyum klorür (AICI3, susuz, 500g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-801081 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Balon Joje (100 ml likl MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beher (10 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beher (100 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beher (25 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Beher (250 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Cam Huni (40 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Cerrahi Makas Sağlık Hizmetleri Meslek Yüksekokulu Lesurin Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Cıva oksit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-108846 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Demir klorür (FeCl3, 500 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-803945 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
EC Antrm Reaktoru MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Elemental Analiz MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Yıldıray TOPCU 3623121919 BAP
Elon Joje (250 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Eozin Y (25 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-115935 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Erlen (50 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Etil alkol (%96'lık 5 L)85,0010 adet850,00Doku takibi, Dehidrasyon için, Sağlık Hizmetleri Meslek Yüksekokulu Aytaş Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Etil alkol (Absolu, susuz, 2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Isolab-920.026.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Formaldehit (25 L) Sağlık Hizmetleri Meslek Yüksekokulu Tekkin-060160.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Glasial asetik asit (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Merck-101830 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
KOİ ÖLÇÜM KİTİ MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Ksilol (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Sigma-16446 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lamel (100adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Superior-C911050 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Mezur (10 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Mezur (100 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Mezur (50 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Pas boya Sağlık Hizmetleri Meslek Yüksekokulu Biognast-Pass-100 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Whatman Grade 589/5 Kırmızı Filtre Kağıdı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Çelik pens Sağlık Hizmetleri Meslek Yüksekokulu Isolab-048.01.145 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
İNTRAOPERATİF MOBİL ANJIYO SİSTEMİ TIP FAKÜLTESİ Prof.Dr. Mustafa Kemal DEMIRAĞ 3623121919 BAP
0.5 µL Eppendorf , 1000 LİK DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Tuğrul KIRTILOĞLU 3623121919 BAP
20 ya da 25'lik Lam boyama sepeti 58,0020 adet1.160,00Preperatları alkol, ksilol ve boya serilerinden toplu olarak geçirmek için Sağlık Hizmetleri Meslek Yüksekokulu L290410 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Aliminyum amonyum sülfat Sağlık Hizmetleri Meslek Yüksekokulu Merck-101031 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Aliminyum amonyum sülfat Sağlık Hizmetleri Meslek Yüksekokulu Merck-101031 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Alkol ZİRAAT FAKÜLTESİ Prof.Dr. Berna TUNALI 3623121919 BAP
Alüminyum klorür (AICI3, susuz, 500g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-801081 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Alüminyum klorür (AICI3, susuz, 500g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-801081 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Bebek tam boy CPR eğitim maketi Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/2901 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
CEREC BLOK - 8'LİK DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
CEREC MC MİLL 6'LIK DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Cad/Cam koni frez DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi İsmail UZUN 3623121919 BAP
Cam Fiber Post DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi İsmail UZUN 3623121919 BAP
Cerrahi Makas Sağlık Hizmetleri Meslek Yüksekokulu Lesurin Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Cerrahi Makas Sağlık Hizmetleri Meslek Yüksekokulu Lesurin Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
CİTRİC ACİD DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Cıva oksit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-108846 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Cıva oksit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-108846 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Demir klorür (FeCl3, 500 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-803945 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Demir klorür (FeCl3, 500 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-803945 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Disposable mikrotom bıçağı 50'lik Sağlık Hizmetleri Meslek Yüksekokulu Facefath Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Döner sistem kanal aleti DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi İsmail UZUN 3623121919 BAP
EMG Analizi YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
ENTELLAN (100ML) Sağlık Hizmetleri Meslek Yüksekokulu 107961 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
El araçları Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
Elektronik Sarf Malzeme Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
Eozin Y (25 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-115935 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Eozin Y (25 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck-115935 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Etil alkol (%96'lık 5 L)85,0010 adet850,00Doku takibi, Dehidrasyon için, Sağlık Hizmetleri Meslek Yüksekokulu Aytaş Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Etil alkol (%96'lık 5 L)85,0010 adet850,00Doku takibi, Dehidrasyon için, Sağlık Hizmetleri Meslek Yüksekokulu Aytaş Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Etil alkol (Absolu, susuz, 2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Isolab-920.026.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Etil alkol (Absolu, susuz, 2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Isolab-920.026.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Eğitim tipi otomatik eksternal defibrilatör ve manken seti Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/2850 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Feldspatik Blok DİŞ HEKİMLİĞİ FAKÜLTESİ Dr.Öğr.Üyesi İsmail UZUN 3623121919 BAP
Ferric ammonium sulphate (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Filtek Z-250 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Filtek ᵀᴹ Bulk Fill Posterior Restorative DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Fli-1 7ml TIP FAKÜLTESİ Bio SB Dr.Öğr.Üyesi Seda GÜN 3623121919 BAP
Formaldehit (25 L) Sağlık Hizmetleri Meslek Yüksekokulu Tekkin-060160.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Formaldehit (25 L) Sağlık Hizmetleri Meslek Yüksekokulu Tekkin-060160.2500 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Glasial asetik asit (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Merck-101830 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Glasial asetik asit (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Merck-101830 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Harris's alum hematoksilen 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 109253 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Havya Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
Hematoksilen solüsyonu 500 mL Sağlık Hizmetleri Meslek Yüksekokulu 105174 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Kaza Simülasyon Makyaj/Molaj Kiti Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/818 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Klampermetre Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
Ksilol (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Sigma-16446 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Ksilol (2,5 L) Sağlık Hizmetleri Meslek Yüksekokulu Sigma-16446 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lam (50 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lam boyama kabı (20 ya da 25'lik kapaklı) 45,0060 adet2.700,00Lam üzerindeki dokuların deparafinizasyon, şeffaflaştrıma, boyama işlemlerinde kullanmak için, Sağlık Hizmetleri Meslek Yüksekokulu L290411 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lamel (100adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Superior-C911050 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Lamel (100adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Superior-C911050 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Max Cem Siman DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Metronom (Sağlık Bakanlığı yeni yönetmeliğine uygun) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
N-HEPTAN DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Oksalik asit (500 g) Sağlık Hizmetleri Meslek Yüksekokulu Isolab Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Pas boya Sağlık Hizmetleri Meslek Yüksekokulu Biognast-Pass-100 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Pas boya Sağlık Hizmetleri Meslek Yüksekokulu Biognast-Pass-100 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
PerioPaper® GCF Collection Strips 20×16 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Tuğrul KIRTILOĞLU 3623121919 BAP
Phosphotungustic asit (100 g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Protaper Next x1-x3 set DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Ses analiz sonuçlarının analizi ve istatistiksel değerlendirilmesi ve ses kaydı YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Özgür BOSTANCI 3624577600 BAP
SonicFill ᵀᴹ Kompozit DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
TAVŞAN DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Emel BULUT 3623121919 BAP
TEKSOL %96 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Temel Devre Elemanları Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
Tetric EvoCeram® Bulk Fill DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Yetişkin tam vücut CPR eğitim maketi Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/2700 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Yetişkin yarım boy CPR eğitim maketi Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/2801 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Çelik pens Sağlık Hizmetleri Meslek Yüksekokulu Isolab-048.01.145 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Çelik pens Sağlık Hizmetleri Meslek Yüksekokulu Isolab-048.01.145 Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
Çocuk yarım boy CPR eğitim maketi Sağlık Hizmetleri Meslek Yüksekokulu Simulaids/2271 Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Ölçü aleti(AVOmetre) Yeşilyurt Demir-Çelik Meslek Yüksekokulu Öğr.Gör.Dr. Harun SÜMBÜL 3623121919 BAP
İyot (100g) Sağlık Hizmetleri Meslek Yüksekokulu Merck Öğr.Gör.Dr. Nurhan ÇON 3623121919 BAP
İzokinetik Analiz YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
Gibberellik asit ZİRAAT FAKÜLTESİ merck Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
IBA (Indol Bütirik Asit) ZİRAAT FAKÜLTESİ merck Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Mikoriza (endo roots soluble) ZİRAAT FAKÜLTESİ bioglobal Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
NMR analiz ücretleri (iki Boyutlu) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
FT-IR FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
Hidrazin hidrat (1 lt) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Hidrojen peroksit ( 2,5 lt) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Hidroklorik asit (2,5 L) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
MRS Agar (Granül formda, 500g) MÜHENDİSLİK FAKÜLTESİ MERCK 110660.500 Prof.Dr. Ahmet Hilmi ÇON 3623121919 BAP
MRS Broth (Granül formda, 500 g) MÜHENDİSLİK FAKÜLTESİ MERCK 110661.500 Prof.Dr. Ahmet Hilmi ÇON 3623121919 BAP
NMR FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
Potasyum permanagant(2,5 kg) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Sodyum Nitrat (1 kg) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Sülfürik asit (2,5 lt) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Toz grafit (2,5 kg merck) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
UV/VIS Spectrophotometer Fixed wavelength:190~1100nm MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hüseyin GENÇCELEP 3623121919 BAP
GC-MS MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
GC-MS MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
ICP-OES MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
ICP-OES MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Ana Sedye Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Asgari 6 değişik parçalı şişme atel ve vakum atel seti Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Boyunluk seti en az üç boy Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Canlandırma ünitesi (Balon valf maske seti, laringoskop seti, portatif oksijen tüpü, entübasyon tüpleri, havayolu tüpü, oro/nazofaringeal kanüller, kolorimetrik cihaz) LMA (Laringeal Mask Airway), Kombi Tüp, Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Diagnostik set (otoskop,oftalmoskop,rinoskop) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
DİJİTAL AĞIZİÇİ FOSFOR PLAK TARAYICISI DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Enjektör pompası Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Faraş sedye Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Hygiene Box-2 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
KED kurtarma yeleği Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Kavitron cihazı DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Klasik tansiyon aleti Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Kombinasyon sedye Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
PERİAPİKAL DİŞ RÖNTGEN CİHAZI DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ali KELEŞ 3623128250 BAP
Portatif aspiratör Sağlık Hizmetleri Meslek Yüksekokulu OSCAR Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Steteskop Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Sırt tahtası pediatrik (Baş sabitleyici ve örümcek kemer sistemi ile birlikte) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Sırt tahtası yetişkin (Baş sabitleyici ve örümcek kemer sistemi ile birlikte) Sağlık Hizmetleri Meslek Yüksekokulu EMS/O.T. Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Traksiyon atel seti Sağlık Hizmetleri Meslek Yüksekokulu EMS Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Vakum sedye Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
İnfüzyon pompası Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
2B dereceli tahta kurşun kalem (12li paket) EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
80 gr lık A4 fotokopi kağıdı EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
A4 Delikli Poşet Dosya EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
A4 Kağıdı EĞİTİM FAKÜLTESİ Prof.Dr. Ufuk ÇORUH 5332230144 BAP
A4 geniş klasör EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Dust-Free sınav silgisi EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
Kitap EĞİTİM FAKÜLTESİ Prof.Dr. Ufuk ÇORUH 5332230144 BAP
YAZILABİLİR CD EĞİTİM FAKÜLTESİ Prof.Dr. Ufuk ÇORUH 5332230144 BAP
0,5X OBJEKTİF FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT 3623121919 BAP
Bosu Topu YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Mehmet Yalçın TAŞMEKTEPLİGİL 3121919567 BAP
Gamry Referans 600 Potansiyostat Elektrokimyasal testler için yazılım güncellenmesi FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ömer ANDAÇ 3623121919 BAP
Mat YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Mehmet Yalçın TAŞMEKTEPLİGİL 3121919567 BAP
SEM (Taramalı Elektron Mikroskop) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Mevlüt GÜRBÜZ 3623121919 BAP
Toprak saksısı ZİRAAT FAKÜLTESİ Prof.Dr. Zeki ACAR 3623121919 BAP
Wistar Albino Rat TIP FAKÜLTESİ Doç.Dr. Aydın HIM 3623121919 BAP
X-Işını Kırınımı (XRD) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Mevlüt GÜRBÜZ 3623121919 BAP
Çizim ataşmanı FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nazmi POLAT 3623121919 BAP
Etanol, %99.8 saflığında yada ondan fazla MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Basma Testi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Beautifil Bulk Flowable (Shofu Inc, Kyoto, Japan) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Beautifil Bulk Restorative (Shofu Inc, Kyoto, Japan) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Clinpro Fissür Örtücü DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Dinamik mekanik analiz (DMA) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Filtek Bulk Fill Flowable (3M ESPE, St Paul, MN, USA) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Filtek Supreme XTE Flowable DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Filtek Z-250 (3M ESPE, St Paul, MN, USA) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Filtek Z250 Universal DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Fourier Dönüşümlü Kızıl-ötesi Spektroskopisi (FTIR) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
ICON DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Plastik spektrofotometre küveti (3 ml) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
SDR (Dentsply Caulk, Milford, DE,USA) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Sodyum sitratlı tüp 10 ML (100.LÜK) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
SonicFill (Kerr, Orange, CA, USA) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
TEM analizi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 3623121919 BAP
Taramalı elektron mikroskobu (SEM) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Taramalı-Geçirimli electron mikroskobu (STEM) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Termogravimetrik analiz (TGA) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Tüp - santrfüj - P.P - vidalı kapaklı - 15 ml - DNA/RNA free - steril 50adet/pkt Isolab 078.02.007 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
X-Işını Kırınımı (XRD) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
X-traFil (Voco,Cuxhaven, Germany) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
İnsertliVial+Kapak+SeptumSeti (100 adetlik) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
10 µl lik filtreli pipetucu ( 1 kutu) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
10-100 µl lik pipetucu (1 kutu) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
10-100 µl lik filtreli pipetucu(1 kutu) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
100-1000 µl lik pipetucu (1 kutu) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
100-1000 µl lik filtreli pipetucu (1 kutu) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
A4 Renkli Fotokopi Çekimi (4 sayfa) EĞİTİM FAKÜLTESİ Doç.Dr. Ayşenur BÜYÜKGÖZE KAVAS 3623121919 BAP
DNA Dizi Analizi, çift yön + PCR Temizleme TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
DNA Dizi Analizi, çift yön + PCR Temizleme TIP FAKÜLTESİ Prof.Dr. Belma DURUPINAR 3623121919 BAP
Steril eküvyon pamuklu çubuk TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Steril plastik petri (90mm) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Steril öze TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
İleri Düzey Radyoloji İş İstasyonu ve Cerrahi Planlama Sistemi TIP FAKÜLTESİ Prof.Dr. Mustafa Kemal DEMIRAĞ 3623121919 BAP
Anaerocult A VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Brisa LC2 C18 5 µm 250x4,6 mm ID kolon DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Brisa LC2 C18 5 µm 250x4,6 mm ID kolon DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Dialysis tubing, 16 mm, kapasitesi ~60 mL/ft VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
KETASOL %10 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Emel BULUT 3623121919 BAP
LYSTHENON FORTE AMPUL DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Emel BULUT 3623121919 BAP
Primer VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Primer antikor (mouse monoclonal anti-epsilon toxin ) VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Sekonder antikor (Anti mouse IgG, AP konjuge) VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Taq DNA Polymerase, native VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Wistar Albino Rat TIP FAKÜLTESİ Doç.Dr. Aydın HIM 3623121919 BAP
DNA ladder, 100 bp VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
DNA ladder, 100 bp VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
DNA ladder, 100 bp VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez camı VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez camı VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez camı VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez için 1 ve 1.5 mm lik seperator VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez için 1 ve 1.5 mm lik seperator VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Elektroforez için 1 ve 1.5 mm lik seperator VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Prestained protein ladder VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Prestained protein ladder VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Prestained protein ladder VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Sekonder antikor (Anti sheep IgG, AP konjuge) VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Sekonder antikor (Anti sheep IgG, AP konjuge) VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Sekonder antikor (Anti sheep IgG, AP konjuge) VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Standard PCR MasterMix VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Standard PCR MasterMix VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
Standard PCR MasterMix VETERİNER FAKÜLTESİ Prof.Dr. Oktay GENÇ 3623121919 BAP
KALINLIK-PLANYA MAKİNESİ BAKIM KİTİ FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
ŞERİT TESTERE MAKİNESİ FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Necati MENEK 3623121919 BAP
SEM ile mikroskobik karakterizasyon çalışmaları MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Özgür DEMİRCAN 3623121919 BAP
Sıvı Azot MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
Yüksek saflıkta Argon gazı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Engin BURGAZ 3623121919 BAP
0,2 ml mikrosantrifüj tüpü (Dnase ve Rnase free) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
1,5 ml mikrosantrifüj tüpü (Dnase ve Rnase free) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
100 bp DNA ladder TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
6x Loading dye TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Agaroz jel (PZR uygun) (100gr) TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Blood agar base TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Real Time PCR kullanımı ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
Taq DNA polimeraz 500 u TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Termal Analiz (DMA) (OMÜ-KİTAM) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sevim ALIŞIR 3623121919 BAP
Termal Analiz (TGA-DTA) (OMÜ-KİTAM) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sevim ALIŞIR 3623121919 BAP
dNTP mix 10 mM TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
mcr-1 primer F 20 baz çift TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
mcr-1 primer R 20 baz çift TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
mcr-2 primer 20 baz çift TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
mcr-2 primer F 20 baz çift TIP FAKÜLTESİ Doç.Dr. Yeliz TANRIVERDI ÇAYCI 3623121919 BAP
Çekme Testi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sevim ALIŞIR 3623121919 BAP
İklimlendirme kabini kullanımı ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
Merkezi Veri Donanımı ve Network Alt Yapısı Sistemi (Sunucular, Veri depolama ünitesi, MAS yedekleme ünitesi, Omurga Switch, Kenar switch, Yedekleme Yazılımı (4 CPU), yazılımlar, Modüler veri merkezi) TIP FAKÜLTESİ Doç.Dr. Tekin ŞİMŞEK 3623121919 BAP
25-OH Vitamin D3-HPLC DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
8-OHDG ELISA kiti 96 test SUNREDBIO MARKA.KATALOG.NO:201-12-1437 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
ALT (GPT) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
AST (GOT) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
Akülü Vidalama MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ 3623121919 BAP
Alkalen Fosfataz (ALP) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
Büret (25 ml) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Diş Hekimi Muayenesi DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
Fosfor (P) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
IL-6 ELISA kiti 96 test SUNREDBIO MARKA.KATALOG NO:201-12-0091 DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
Kalsiyum (Ca) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
Kjeldahl Azot Tüpü MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Ortopantomograf Film (Panoramik) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
Parathormon (PTH) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Aysun AVŞAR 3121919278 BAP
etil alkol MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
İnsansı Robot MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi İbrahim İNANÇ 3623121919 BAP
16 Gb USB bellek ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
2,2'-oxybis-ethanethiol cas no:2150-02-9 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
2-(2-Aminoethoxy)ethanol cas no:929-06-6 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
5- Bromo- 4- floro- 2- hidroksibenzaldehid 399-00-8 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
5-Bromo-2-hydroxy-4-methoxybenzaldehyde casno:57543-36-9 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
A4 kağıdı ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
Asetat Kalemi (Siyah-Mavi-Kırmızı-Yeşil 4'lü) (silinmeyen permanent 1 mm çizgi kalınlığında) ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
Borik Asit ZİRAAT FAKÜLTESİ AMRESCO Prof.Dr. Hüsrev MENNAN 3623121919 BAP
DNAEASY mini bitki kiti 250u ZİRAAT FAKÜLTESİ MN Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Dar Klasör ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
ETH Bromur 10mg/ml 10m ZİRAAT FAKÜLTESİ SNP BİYOTEK. Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Hard disk (2.5" lik 1TB) ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
Herbisit ZİRAAT FAKÜLTESİ Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Kartuş ZİRAAT FAKÜLTESİ Prof.Dr. İlknur AYAN 3623121919 BAP
Latex Eldiven ZİRAAT FAKÜLTESİ BEYBİ Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Mavi Eldiven ZİRAAT FAKÜLTESİ BEYBİ Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Neclease free su ZİRAAT FAKÜLTESİ BİO.İND Prof.Dr. Hüsrev MENNAN 3623121919 BAP
PCR Purifikasyon Kiti 250u ZİRAAT FAKÜLTESİ MN Prof.Dr. Hüsrev MENNAN 3623121919 BAP
RNA Ekstrasiyon Kiti 50u ZİRAAT FAKÜLTESİ MN Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Torf ZİRAAT FAKÜLTESİ Prof.Dr. Hüsrev MENNAN 3623121919 BAP
Tris Base ZİRAAT FAKÜLTESİ SERVA Prof.Dr. Hüsrev MENNAN 3623121919 BAP
0,5 ml mikrosantrifüj tüpü (1 kutu/5000 adet) nonsteril Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
0,5-5 mL lik Otomatik Pipet Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
1,5 ml mikrosantrifüj tüpü (1 kutu/5000 adet) nonsteril Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
15 ml Santrifuj tüpü (vidalı kapaklı) (1 paket) nonsteril Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
50 ml Santrifuj tüpü (Vidalı kapaklı) (1 paket) nonsteril Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
AU/PD KAYNAĞI (Quorum SC7620 Sputter Coater cihazı ile uyumlu) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Acil doğum seti Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Ambulans Tipi Temel tıbbi malzeme çantası (yüzük kesme makası, turnike, steril spanç, kompres, kanama durdurucu materyal, sargı bezi, elastik bandaj ve plaster içermeli) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Battaniye( 160x240cm) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Beckman Coulter Agencourt AMPure XP-60ml (1 adet) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
DNA Ekstraksiyon Kiti 250 PREPS Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Digital Termometre Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
EvaGreen, qPCR Master Mix (200 RXN) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Kadın ve Erkek Üriner Kateterizasyon Simülatörü Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Kan şekeri ölçüm cihazı Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Kol&Bacak Sütur Atma Eğitim Maketi Set Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Kızılötesi timpanik ateş ölçer Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
OTOMATİK PİPET, 10-100 MİKRON (10 paket pipet ucu ile beraber) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
PCR Master Mix (100 reaksiyonluk) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
PCR Pürifikasyon Kiti (50 RXN) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
PCR tüpü 0,2 ml, steril (500 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Polipropilen Tüp (1000 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Polistiren Tüp (1000 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Qubit Assay tüpleri (500 adet/paket) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Qubit dsDNA BR Assay Kit (2-1000 ng) Q32853 Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Qubit dsDNA HS Assay Kit Q32854 Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Tam Boy Motorlu Doğum Maketi Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Travma Girişim Uygulama Mankeni Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Trizol (200 mg/şişe) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Yanık seti (Alüminyum veya jel esaslı yanık örtüsü, yanık sargısı ve kompresler) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Yenidoğan CPR ve Havayolu mankeni Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Yetişkin CPR ve Havayolu mankeni Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
cDNA sentez kiti (200 reaksiyonluk) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Çocuk CPR ve Havayolu mankeni Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
İso-BUTİL METİL KETON(Chem Pure) Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
İğne dekompresyon seti Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
7-Nitroindazole 1 g TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Amber şişe (10 ml, 25 ml, 50 ml) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Aminoguanidin hidroklorit 25 g TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Basınçlı sprey 1 L kapasite, 3 bar basınç ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Hormon Analizi (progesteron) VETERİNER FAKÜLTESİ Doç.Dr. Serhan Serhat AY 3623121919 BAP
L NAME 1 g TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
L-Arginin 100 g TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Laboratuvar eldiveni 100 lü (large) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Resveratrol 100 mg TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Resveratrol 500 mg TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Strafor(köpük) kasa 50x40x26 cm (kapaklı) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Toprak dikdörgen saksı(100x20x17cm) 20L ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Toprak saksı (1.7 L hacim, geniş ağızlı) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Toprak saksı (2 L geniş ağızlı) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
UV quartz cuvette 1.4 ml (2) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Vilazodon hydrochloride 10 mg TIP FAKÜLTESİ Prof.Dr. Mustafa AYYILDIZ 3623121919 BAP
Viyol (9x5)45'lik ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
p-Nitro Blue Tetrazolium (NBT) 840W-1KT ZİRAAT FAKÜLTESİ MERCK Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
sodium nitroprusside (SNP) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Çiçek soğanı (iris) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Çiçek soğanı (lilyum) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Üretim saksı siyah (2 lt hacim) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Üretim saksısı (2 L) ZİRAAT FAKÜLTESİ Prof.Dr. Fisun G. ÇELİKEL 3623121919 BAP
Moleküler Biyoloji ve Genetik Bölümü Öğrenci Laboratuvarı Kurulumu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Nevzat ŞAHIN 3623121919 BAP
80 gr. A4 fotokopi kağıdı ZİRAAT FAKÜLTESİ Prof.Dr. Hasan ÖNDER 3623121919 BAP
A4 Delikli Poşet Dosya( 100 Adet ) ZİRAAT FAKÜLTESİ Prof.Dr. Hasan ÖNDER 3623121919 BAP
Dar klasör (5 cm) ZİRAAT FAKÜLTESİ Prof.Dr. Hasan ÖNDER 3623121919 BAP
Lazer Yazıcı ZİRAAT FAKÜLTESİ EPSON Prof.Dr. Hasan ÖNDER 3623121919 BAP
MD20 EETQ BOX ORAL JET DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
MD20 EETQ BOX ORAL JET DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
İmza kalemi (Mavi) ZİRAAT FAKÜLTESİ Prof.Dr. Hasan ÖNDER 3623121919 BAP
Bistüri ucu 10'luk, 100 adet/paket ZİRAAT FAKÜLTESİ MEDPOİNT Doç.Dr. Musa KAVAS 3623121919 BAP
Bradford reagent (500 ml) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Burcu BAŞ 3123121919 BAP
Buzdolabı ZİRAAT FAKÜLTESİ PROFİLO 2053W2VN Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
Eldiven (pudrasız, Medium) ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
Filtre Kağıdı (Mavi bant) 125 mm MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Plastik Steril Petri Kabı 90mm (500adet/paket) ZİRAAT FAKÜLTESİ FIRAT Doç.Dr. Musa KAVAS 3623121919 BAP
Proteinaz K, 25 mg ZİRAAT FAKÜLTESİ MG-PASEK Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Sodium phosphate dibasic dodecahyrate 1kg ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Sülfürik asit (H2SO4) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Taq-Man Universal Master Mix ZİRAAT FAKÜLTESİ MG-TAQMX-01 Dr.Öğr.Üyesi Yilmaz KAYA 3623121919 BAP
Top hızı ölçer (radar tabancası) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
dNTP, 10 mM mix, 1ml ZİRAAT FAKÜLTESİ MG-DNTP-10 Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
İnkübatör-Soğutmalı Etüv VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
EndoSequence (25.04) kanal eğesi Brasseler USA, Savannah, GA DİŞ HEKİMLİĞİ FAKÜLTESİ BRASSELER Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
F360 (25.04) kanal eğesi Komet, Brasseler GmbH & Co., Lemgo, Germany DİŞ HEKİMLİĞİ FAKÜLTESİ BRASELLER Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
Genius File (25.04) kanal eğesi Ultradent Product Inc., South Jordan, UT, USA DİŞ HEKİMLİĞİ FAKÜLTESİ ULTRADENT Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
Mobil İş İstasyonu MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Yıldıray TOPCU 3623121919 BAP
ALT (GPT) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
AST (GOT) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
CRP YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
Kreatinin YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
Prox antibody 100 ug TIP FAKÜLTESİ ABCAM Dr.Öğr.Üyesi Seda GÜN 3623121919 BAP
Troponin-I YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
ISITICILI MAGNETİK KARIŞTIRICI MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
KOİ Ölçüm Kiti MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Artım Burgusu 400mm Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Artım Burgusu 600mm Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Ağaç Kabuk Kalınlığı Ölçer Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BALTA Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BALYOZ Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 10 ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 100 ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 1000 ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 250 ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 25ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BEHER 50 ML (CAM) Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
BUDAMA MAKASI Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Bilgisayar Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Duvara Monte Yazı Tahtası Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Elektronik Pusula Ve Boy Ölçer Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Elektronik Pusula Ve Eğim Ölçer Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Etüv Fırını Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
GPS Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Hassas Terazi Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
KESER Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Ph Metre Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Projeksiyon Cihazı Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Promega 1000 bp DNA Ladder G5711 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ 3623121919 BAP
Toplantı Masası Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
ÇEKİÇ Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çap Ölçer 500mm Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çap Ölçer 650mm Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çap Ölçer 950mm Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çelik Şeritmetre 20 Mt. Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çelik Şeritmetre 30 Mt. Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
Çelik Şeritmetre 50 Mt. Vezirköprü Meslek Yüksekokulu Prof.Dr. Kemalettin ŞAHİN 3623121919 BAP
PCA SET TIP FAKÜLTESİ Prof.Dr. İsmail Serhat KOCAMANOĞLU 3623121919 BAP
22" EkranlıGrafik Tablet GÜZEL SANATLAR FAKÜLTESİ Doç.Dr. Ali SEYLAN 3623121919 BAP
1 ml pipet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
10 ml pipet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
5 ml pipet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
600 ml beher MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
A4 Kağıdı (Paket) ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
Amonyum klorür (NH4Cl) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Cam Yazar ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
DNA dizi analizi (saflaştırma ve çift yönlü dizileme VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Elemental Analiz MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Yıldıray TOPCU 3623121919 BAP
Etil Alkol (%96'lık) ZİRAAT FAKÜLTESİ ALKOMED Doç.Dr. İsmail ERPER 3623121919 BAP
Etil Alkol (Lt) % 96'lık ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
H3BO3 (Borik asit) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Kağıt havlu (12'li paket) ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
Lam (Kutu) ZİRAAT FAKÜLTESİ isotek Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
Lamel (15x15 mm kare) (Kutu) ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
Magnezyum klorür (MgCl2.6H2O) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Maske (Kutu) ZİRAAT FAKÜLTESİ bonex Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
Potasyum di-hidrojen fosfat (KH2PO4) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Saat camı (60mm) ZİRAAT FAKÜLTESİ medex Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
di-Sodyum tetra borat (Na2B4O7.10H2O) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Şeffaf dosya (100'lük) ZİRAAT FAKÜLTESİ Prof.Dr. Sebahat SULLIVAN 3623121919 BAP
1000 Adet fotokopi Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
1000 Adet fotokopi Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
64 GB USB Flash Bellek Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
64 GB USB Flash Bellek Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
A4 Kağıdı Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
A4 Kağıdı Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Anti-BMP2 antibody 100 µg DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nilüfer ÖZKAN 3623121919 BAP
Anti-RUNX2 antibody 100 µg DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nilüfer ÖZKAN 3623121919 BAP
Büyük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Büyük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
CD-R Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
CD-R Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
DVD Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
DVD Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
HRP/AEC(ABC) Detection IHC Kit 15 ml DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nilüfer ÖZKAN 3623121919 BAP
Kalem Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Kalem Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Küçük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Küçük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Orta boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Orta boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Sıçan bakım ücreti (28 adet) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Yıldırım KAYACAN 5056080344 BAP
Tarla İçi Sulama Sistemleri ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL 3623121919 BAP
Telli Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Telli Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
İnsan GRP78 ELISA kiti TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Alper ARSLAN 3623121919 BAP
Şeffaf Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Şeffaf Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Q enzim Q10 YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Yıldırım KAYACAN 5056080344 BAP
Santrifüj HAVACILIK VE UZAY BİLİMLERİ FAKÜLTESİ HETTİCH UNİVERSAL 320 Dr.Öğr.Üyesi Sema ARIMAN BAP
Sıçan (Wistar albino, erkek) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Dr.Öğr.Üyesi Yıldırım KAYACAN 5056080344 BAP
0,6 ml'lik PCR mikrosantrifüj (DNaz, RNaz free) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
1,5 ml'lik mikrosantrifüj tüp (DNaz, RNaz free) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
100 bp'lık DNA ladder TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
100 µl'lik pipet ucu TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
1000 µl'lik pipet ucu TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
32 GB Flaş bellek Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
50 ml'lik santrifüj tüpü TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
6x loading dye TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
80 gr. A4 Fotokopi Kağıdı(5'li Paket) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
96 kuyucuklu düz tabanlı polistren mikrotitrasyon plağı (steril ve kapaklı ) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Aseton TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Bilgisayar yazıcı toneri (Samsung ML2165) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Boş DVD ( 50 adet kutu ) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Cam şişe (1000 mlX10) VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Cryo tüp kutusu VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
DNTP mix (10mM) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Deney tüpü TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Eküvyon TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
EndoSequence (25.04) kanal eğesi Brasseler USA, Savannah, GA DİŞ HEKİMLİĞİ FAKÜLTESİ BRASSELER Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
Etanol TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
F360 (25.04) kanal eğesi Komet, Brasseler GmbH & Co., Lemgo, Germany DİŞ HEKİMLİĞİ FAKÜLTESİ BRASELLER Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
Genius File (25.04) kanal eğesi Ultradent Product Inc., South Jordan, UT, USA DİŞ HEKİMLİĞİ FAKÜLTESİ ULTRADENT Prof.Dr. Ebru ÖZSEZER DEMİRYÜREK 3623121919 BAP
Glukoz TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Human IL-10 ELISA kiti 96 testlik SunRedBio 201-12-0103 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
Human IL-1Beta ELISA kiti 96 testlik SunRedBio 201-12-0144 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
Human MMP-1 ELISA kiti 96 testlik SunRedBio 201-12-0917 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
Human MMP-8 ELISA kiti 96 testlik SunRedBio 201-12-0904 DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Burcu Özkan ÇETİNKAYA 3623121919 BAP
Kalemler Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Kristal viyole TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Safranin TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Steril plastik petri (9 cm çap) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Taq DNA polimeraz (500U) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Triptikaz soy buyyon TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Vankomisin disk (30 µg) TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
esp11 primer TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
esp12 primer TIP FAKÜLTESİ Dr.Öğr.Üyesi Kemal BİLGİN 3623121919 BAP
Çok fonksiyonlu yazıcı (1 adet) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
Şeffaf Dosya (100'lük) Sağlık Bilimleri Fakültesi Dr.Öğr.Üyesi Birsen ALTAY 3623121919 BAP
1.5 ml lik eppendorf tüpü 1000 adet/poşet ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
2ml lik eppendorf tüpü 1000 adet/poşet ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
50 ml Falkon Tüp (50 adet/poşet) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Absolut etanol, 2.5 l ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Casein Hydrolysate 500 g ZİRAAT FAKÜLTESİ sigma Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
NaCl 1kg ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
POTASSİUM DİHYDROGEN PHOSPHATE 1 kg ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Poly[-3-hydroxybutyric acid] 10gr ZİRAAT FAKÜLTESİ sigma Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Potassium Chloride 1 kg ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Sodium L - glutamate 250 gr ZİRAAT FAKÜLTESİ sigma Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Sodium bromür 1 KG ZİRAAT FAKÜLTESİ merk Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
mtDNA Stokromb gen bölgesi 1100 baz çiftlik çift yönlü okuma ve saflaştırma FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Haluk KEFELİOĞLU 3623121919 BAP
CNC DİK İŞLEME MERKEZİ MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Kemal YILDIZLI BAP
Promega 1000 bp DNA Ladder G5711 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. İbrahim ÖZKOÇ 3623121919 BAP
52X 700MB 50li kutuda tekrar yazılabilir CD+R Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
80 g hamur A4 kağıt 500 lü Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
80 gr. A4 Fotokopi Kağıdı(5'li Paket) Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
A4 Delikli Poşet Dosya( 100 Adet ) Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Bilgisayar yazıcı toneri Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
DVD ( 50 adetlik 1 kutu ) Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Mavi tükenmez kalem Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Mavi tükenmez kalem Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Plastik Klasör Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Telli dosya Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Ultramikrotom ve Taramalı elektron mikroskobu kullanımı TIP FAKÜLTESİ Dr.Öğr.Üyesi Mehmet Emin ÖNGER 3623121919 BAP
Çıtçıtlı plastik dosya Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Çıtçıtlı plastik dosya Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
A4 kağıt ZİRAAT FAKÜLTESİ Doç.Dr. Ayhan HORUZ 3623121919 BAP
Aktif karbon ZİRAAT FAKÜLTESİ merck Doç.Dr. Ayhan HORUZ 3623121919 BAP
Amonyak (Ammonia Solution 25%) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Amonyum asetat ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Amonyum asetat ZİRAAT FAKÜLTESİ İSOLAB Doç.Dr. Ayhan HORUZ 3623121919 BAP
Asetik Asit ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Asetik Asit 2,5lt i ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Azometin H ZİRAAT FAKÜLTESİ merck Doç.Dr. Ayhan HORUZ 3623121919 BAP
Balon joje 100 ml ZİRAAT FAKÜLTESİ saha Doç.Dr. Ayhan HORUZ 3623121919 BAP
Balon joje 50 ml ZİRAAT FAKÜLTESİ saha Doç.Dr. Ayhan HORUZ 3623121919 BAP
Borik Asit ZİRAAT FAKÜLTESİ MERCK Doç.Dr. Ayhan HORUZ 3623121919 BAP
Büret 25mI ZİRAAT FAKÜLTESİ saha cam musluk Doç.Dr. Ayhan HORUZ 3623121919 BAP
DİZÜSTÜ BİLGİSAYAR ZİRAAT FAKÜLTESİ ASUS FX503VD Prof.Dr. Kürşat DEMIRYÜREK 3623121919 BAP
Fosforik asit (H3PO4) ZİRAAT FAKÜLTESİ Tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Fosforik asit (H3PO4) ZİRAAT FAKÜLTESİ İSOLAB Doç.Dr. Ayhan HORUZ 3623121919 BAP
Glacial Acetic Acid ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Glacial Asetik Asit ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Glacial Asetik Asit ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Hidroklorik asit (HCI) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Hidroklorik asit (HCI) ZİRAAT FAKÜLTESİ İSOLSB Doç.Dr. Ayhan HORUZ 3623121919 BAP
Nitrik asit (HNO3) ZİRAAT FAKÜLTESİ merck Doç.Dr. Ayhan HORUZ 3623121919 BAP
Nitrik asit (HNO3) ZİRAAT FAKÜLTESİ İSOLAB Doç.Dr. Ayhan HORUZ 3623121919 BAP
Plastik vida kapaklı santrifüj tüpü 15 ml ZİRAAT FAKÜLTESİ savna non steril Doç.Dr. Ayhan HORUZ 3623121919 BAP
Saklama kabı 80 ve 100 ml plastik vida kapaklı ZİRAAT FAKÜLTESİ non steril Doç.Dr. Ayhan HORUZ 3623121919 BAP
Saklama kabı 80 veya 100 ml plastik vida kapaklı ZİRAAT FAKÜLTESİ LP ITALİANA SPA Doç.Dr. Ayhan HORUZ 3623121919 BAP
Sodyum hidroksit (NaOH) ZİRAAT FAKÜLTESİ merck Doç.Dr. Ayhan HORUZ 3623121919 BAP
Sodyum hidroksit (NaOH) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Sülfirik asit (H2SO4) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Sülfirik asit (H2SO4) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Sülfirik asit (H2SO4) ZİRAAT FAKÜLTESİ tekkim Doç.Dr. Ayhan HORUZ 3623121919 BAP
Wistar Albino Rat TIP FAKÜLTESİ Doç.Dr. Aydın HIM 3623121919 BAP
2TB Taşınabilir Disk EĞİTİM FAKÜLTESİ Prof.Dr. Seher Balci ÇELİK 3623121919 BAP
80 g hamur A4 kağıt 500 lü EĞİTİM FAKÜLTESİ Prof.Dr. Seher Balci ÇELİK 3623121919 BAP
Balon joje 1000ml Lamtek LT1001160 ZİRAAT FAKÜLTESİ Doç.Dr. Hakan ARSLAN 3623121919 BAP
Balon joje 2000ml Lamtek LT1001170 ZİRAAT FAKÜLTESİ Doç.Dr. Hakan ARSLAN 3623121919 BAP
CAD/CAM bloğu (GC Cerasmart)(hibrit nanos seramik) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
CAD/CAM bloğu (IPS e.Max)(lityum disilikat) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
CAD/CAM bloğu (Vita Enamic)(hibrit seramik) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
Cam Huni 100mm Lamtek LT1002832 ZİRAAT FAKÜLTESİ lamtek Doç.Dr. Hakan ARSLAN 3623121919 BAP
Dijital Refraktometre 0-85 %Brıx Hanna Marka Hı96801 Model ZİRAAT FAKÜLTESİ HANNA Doç.Dr. Hakan ARSLAN 3623121919 BAP
Embryo tested water 500 ml ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet KURAN 3624576086 BAP
Erlen 100ml Lamtek LT1001520 ZİRAAT FAKÜLTESİ Doç.Dr. Hakan ARSLAN 3623121919 BAP
Guaiacol 100gr Sigma G5502-100G ZİRAAT FAKÜLTESİ sigma Doç.Dr. Hakan ARSLAN 3623121919 BAP
HSP70 antibody ZİRAAT FAKÜLTESİ SANTA CRUZ Prof.Dr. Mehmet KURAN 3624576086 BAP
Hard Disk (6TB) DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ayça Tuba ULUSOY YAMAK 3623121919 BAP
Kanal eğesi DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
L-Proline- from non-animal source, meets EP, USP testing specifications, suitable for cell culture 100gr Sigma P5607-100G ZİRAAT FAKÜLTESİ sigma Doç.Dr. Hakan ARSLAN 3623121919 BAP
Otomatik pipet ucu beyaz 1000 ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet KURAN 3624576086 BAP
Otomatik pipet ucu mavi 1000 ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet KURAN 3624576086 BAP
Otomatik pipet ucu sarı 1000 ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet KURAN 3624576086 BAP
PCR master miks hot start (100 reaksiyon) VETERİNER FAKÜLTESİ Doç.Dr. Cenk Soner BÖLÜKBAŞ 3623121919 BAP
Paper Point DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
Sodium ascorbate 25gr Sigma A7631-25G ZİRAAT FAKÜLTESİ sigma Doç.Dr. Hakan ARSLAN 3623121919 BAP
Sodyum klorid 1000 gr ZİRAAT FAKÜLTESİ sigma Prof.Dr. Mehmet KURAN 3624576086 BAP
Soflex Disk DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
Whatman Filtre Kağıdı MN 640 , 100adet/pkt M&N 105.01.125 ZİRAAT FAKÜLTESİ isolab Doç.Dr. Hakan ARSLAN 3623121919 BAP
Yeşil kuşak fissür frez DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
akışkan kompozit DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
elmas frez DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
güta perka DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
kanal dolgu patı DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
phenol red 5gr ZİRAAT FAKÜLTESİ sigma Prof.Dr. Mehmet KURAN 3624576086 BAP
polieter ölçü maddesi DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
soğuk akrilik DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Elif KALYONCUOĞLU 3623121919 BAP
1-(3-aminopropyl)imidazole FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
27" 2560X1440 ÇÖZÜNÜRLÜKTE MONİTÖR DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Ayça Tuba ULUSOY YAMAK 3623121919 BAP
6-methoxyindole-2-carboxylic asid FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
6x Loading Dye VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Acesulfam K FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
Azobenzen FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
Büyüteç el tipi VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
DNA ekstraksiyon kiti VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Hücre Sıyırıcısı, 13 mm (100 adet) VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Hücre yayıcı Steril tekli poşet (100 adet) VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Kan Alma Tüpü (Jelli 8 ml) VETERİNER FAKÜLTESİ Doç.Dr. Serhan Serhat AY 3623121919 BAP
Kauçuk çift otomatik valfli Pipet Pompası VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Lateks eldiven VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
PCR Hot Start Master Mix VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Pipet pompası, elektrikli VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Primer VETERİNER FAKÜLTESİ Doç.Dr. Gökmen Zafer PEKMEZCI 3623121919 BAP
Rak: 50 ml'lik falcon için VETERİNER FAKÜLTESİ Doç.Dr. Serhan Serhat AY 3623121919 BAP
Rulo sargı bezi (10cmx200 m) VETERİNER FAKÜLTESİ Doç.Dr. Mustafa SALMAN 3623121919 BAP
Steril tek kullanımlık öze, iğneuç/halka uç 10 mikrolitre (1000 adet) VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Steril-swap, Jelsiz (100 adet) VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Thallium (II) acetate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
Yüzeysel Doku Görüntüleme US YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Özgür BOSTANCI 3624577600 BAP
disposable vinil eldiven (100 lük S ve M) VETERİNER FAKÜLTESİ Doç.Dr. Serhan Serhat AY 3623121919 BAP
iki ölçüm proplu elektronik Termometre VETERİNER FAKÜLTESİ Doç.Dr. Ertan Emek ONUK 3623121919 BAP
Florfenikol 100 ml. VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Hemogram seti (100 Testlik) VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Inhalasyon maskesi (farklı ebatlarda) VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Kanlı agar VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Muayene Eldiveni VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
NaS pili ve elektrokimyasal akış kapasitörü bileşenlerinin yapısal karakterizasyonları (SEM, TEM, XRD v.b.) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Berker FIÇICILAR 3623121919 BAP
Steril nasal swab (100'lü) VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Ultrason jeli VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Vakumlu EDTA'lı tüp (100'lük 1 kutu) VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Yoğurt Üretimi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Hasan TEMİZ 3623121919 BAP
Ana Sulama Sistemleri ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL 3623121919 BAP
Dispenser Şişeüstü 2,5-30ml -geri dönüş vanalı Isolab 008.05.030 ZİRAAT FAKÜLTESİ İSOLAB Doç.Dr. Hakan ARSLAN 3623121919 BAP
Meyve Sertliği Ölçüm Cihazı 8mm'lik Uç Gy3 Penetrometre ZİRAAT FAKÜLTESİ Doç.Dr. Hakan ARSLAN 3623121919 BAP
Otoklavlanabilir mavi kap. şişe (500 ml) ZİRAAT FAKÜLTESİ lamtek Doç.Dr. İsmail ERPER 3623121919 BAP
Pompa Birimi ZİRAAT FAKÜLTESİ Doç.Dr. Eyüp Selim KÖKSAL 3623121919 BAP
Raman Spektrumu ölçümü FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Orhan BÜYÜKGÜNGÖR 3623121919 BAP
AFM (atomic force microscopy) ile örneklerin incelenmesi DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Murat YENİSEY 3623121919 BAP
A Kalite Piset (500 ml) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Amonyum asetat (Yerli) 1kg Tekkim ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Analitik tartı kaşığı (paslanmaz çelik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
BET MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Biyobozunur polimer (Polikaprolakton veya Polilaktik asit) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Sevim ALIŞIR 3623121919 BAP
CST STUDIO SUITE MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Begüm Korunur ENGİZ 3623121919 BAP
Cam baget ZİRAAT FAKÜLTESİ SAHA Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Demir sülfat Merck ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Erlen (250 lik)(A Sınıfı) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Etil alkol Yerli ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Etil alkol (1L) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Etil alkol (1L) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Fosforik asit (H3PO4) Tekkim ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Grafen Oksit (Graphen Oxide) Çözeltisi (8 mg/ml, 750 ml lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
HCL (%37) 2.5 L MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Hidrojen Peroksit %35 (1L) Kod: 108600 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Hidrojen Peroksit %35 (1L) Kod: 108600 MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Hidrojen peroksit ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Kaba Filtre Kağıdı (40x40 cm) 1Paket MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Latex Pudralı eldiven (L Beden) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Latex Pudralı eldiven (L Beden) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Parafin Yerli ZİRAAT FAKÜLTESİ BONCUL Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Paslanmaz Spatül MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Permanent Cam/CD Kalemi (M) Kırmızı MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Pipet 10 ml ZİRAAT FAKÜLTESİ LAMTEK Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Pipet 5 ml ZİRAAT FAKÜLTESİ LAMTEK Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Sodyum Hidroksit (teknik) ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Coşkun GÜLSER 3121919139 BAP
Sodyum hekza metafosfat ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Coşkun GÜLSER 3121919139 BAP
Sodyum hidroksit (NaOH) Tekkim ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Sülfirik asit (H2SO4) Tekkim ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Nutullah ÖZDEMİR 3623121919 BAP
Sülfirik asit (teknik) ZİRAAT FAKÜLTESİ TEKKİM Prof.Dr. Coşkun GÜLSER 3121919139 BAP
Tag 250 ünitelik ZİRAAT FAKÜLTESİ sigma Prof.Dr. Berna TUNALI 3623121919 BAP
Tampon çözelti pH=4 250 ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Tampon çözelti pH=7 250 ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
Şırınga Filtre (0,45µm lik) (50 lik) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
RAT BAKIMI (50 ADET) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
Toner (HP Q2612A) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Çetin KURNAZ 3623121919 BAP
COD Kiti 25-1500 mg/L aralığında, Kod: 114541 (25 adet kit/1 kutu) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
COD Kiti 500-10000 mg/L aralığında, Kod: 114455 (25 adet kit/1 kutu) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Nevzat BEYAZIT 3623121919 BAP
DCS DAĞITILMIŞ KONTROL SİSTEMİ (168 ADET SAYISAL GİRİŞ -DI, 112 ADET SAYISAL ÇIKIŞ DO, 28 ADET ANALOG GİRİŞ AI, 12 ADET ANALOG ÇIKIŞ AO MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Erhan ERGÜN 3121919120 BAP
Öğrenci Başlangıç PLC Seti Starter kit with PM564-T-ETH, Ethernet, 24 V DC, hızlı sayıcı modu, 1 X PWM çıkış, 6DI, 6DO, 2AI, 1AO , Similatör kartı MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Erhan ERGÜN 3121919120 BAP
Ankom F57 torba ZİRAAT FAKÜLTESİ ANKOM Prof.Dr. Mehmet Akif ÇAM 3623121919 BAP
Ankom FND 20 C ZİRAAT FAKÜLTESİ ANKOM Prof.Dr. Mehmet Akif ÇAM 3623121919 BAP
Ankom XT4 torba ZİRAAT FAKÜLTESİ ANKOM Prof.Dr. Mehmet Akif ÇAM 3623121919 BAP
Kesif yem (8.1 ton kesif yem) ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Akif ÇAM 3623121919 BAP
RAT FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
Spektrum Analizör MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Çetin KURNAZ 3623121919 BAP
(R)-(-)-Carvone(R)-5-isopropenyl-2-methyl-2-cyclohexeno 100 ml ) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
2-Hydroxy-3-(Trifluoromethoxy)Benzaldehyde 1g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
2-Hydroxy-5-(trifluoromethoxy)benzaldehyde 500 mg FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
3-chloro-2-hydroxybenzaldehyde FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
4-Bromo-2-methoxybenzaldehyde FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
6-Bromo-2-hydroxy-3-methoxy-benzaldehyde FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Erbil AĞAR 3622312191 BAP
9-Formyl-8-hydroxy-1,1,7,7-tetramethyljulolidine (1g) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
DL-5-Hydroxylysine hydrochloride 100 mg FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
DLAB digital single chanel microliter 20-200 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Decylamine %95 25 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Dialysis tubing closures blue, size 50 mm FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Hydrochloric acid %37 2,5 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Kuvars küvet spektrofotometre 300 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
L-Cysteine 100 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
L-Lysine 25 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Methanol anhydrous, 99.8% 2 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Petroleum eter 5 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Propylamine 500 ml -500ML FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Salicylaldehyde β-D-glucoside 1 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Single channel microlitre pipettes transferpettes, variable 20-200 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
trans-4-Hydroxy-L-proline 5 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
0,2 UM LİK STERİL FİLTRE 50 adet ZİRAAT FAKÜLTESİ sarstedt Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
0,5- 10 UL pipet ucu (1000 adet/poşet) ZİRAAT FAKÜLTESİ latorent Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
1- bütanol 2,5 litre ZİRAAT FAKÜLTESİ merck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
1-200 ul lik Pipet ucu (1000 adet/ poşet) ZİRAAT FAKÜLTESİ saha Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
100-1000 ul lik pipet ucu ( 500 adet/poşet) ZİRAAT FAKÜLTESİ saha Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
2000 adet plastik steril petri plak 90mm çaplı ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
50 ml lik falkon(50 adet/poşet) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
500 ml lik otoklavlanabilir çentikli erlen 15 adet ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
ACETONE 2.5L ZİRAAT FAKÜLTESİ tekkim Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Agaroz, 100 gr ZİRAAT FAKÜLTESİ biomax Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Beyaz uç 1000 adet/paket ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Boric Acid (1Kg) ZİRAAT FAKÜLTESİ merck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
D(+) glucose Monohydrate 1 kg ZİRAAT FAKÜLTESİ merck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Eva green qPCR supermix ZİRAAT FAKÜLTESİ solis bio dyn Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
HCl, 2.5 l ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Kloroform, 2.5 l ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Laptop Bilgisayar MÜHENDİSLİK FAKÜLTESİ LENOVO V330 81AXOOESTX Prof.Dr. Ahmet Hilmi ÇON 3623121919 BAP
MAGNESİUM SULPHATE HEPTAHYDRATE (2,5 kg) ZİRAAT FAKÜLTESİ merck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Mavi uç, 500 adet/paket ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Metanol, 2.5 l ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Methanol 2,5 Lt ZİRAAT FAKÜLTESİ Tekkim Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
NaCl 1kg ZİRAAT FAKÜLTESİ meck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
NaCl, 1kg ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Petrol Eteri 5 lt ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Potassium clavulanate 100mg ZİRAAT FAKÜLTESİ SİGMA Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
RNA izolasyon kiti, RNeasy Mini Kit ZİRAAT FAKÜLTESİ Amp Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Rnaz free DNAz free 0.2 ml lik PCR tüpü, 1000 adet/paket ZİRAAT FAKÜLTESİ axygen Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Sarı uç, 1000 adet/paket ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
TURBO DNA free, 50 rxns ZİRAAT FAKÜLTESİ Zymo Research Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
UREA 1 KG ZİRAAT FAKÜLTESİ Carloerba Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Whatman 3 MM kağıt ZİRAAT FAKÜLTESİ gel blotting paper Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Yeast Extract Granulated 500g ZİRAAT FAKÜLTESİ merck Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
benzen 2,5 lt ZİRAAT FAKÜLTESİ isolab Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
cDNA sentez kiti 200 reaksiyonluk ZİRAAT FAKÜLTESİ Thermo Fisher Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
sodium hypochloride solution 2,5 lt ZİRAAT FAKÜLTESİ Tekkim Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
İzopropanol (2,5L) ZİRAAT FAKÜLTESİ Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
Beautifil-Bulk Restorative DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Nihan GÖNÜLOL 3623121919 BAP
1 Adet Masa Üstü Bilgisayar EĞİTİM FAKÜLTESİ Doç.Dr. Salih RAKAP 5304629173 BAP
1 kbp DNA marker MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
100 bp DNA marker MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
100 ml balon joje MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
1000 ml balon joje MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
15 mL clear vial, screw top hole cap with PTFE Silicone Septa (Supelco, USA) kod: 27159 MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
25 ml balon joje MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
25 ml pipet MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
50 ml balon joje MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
500 balon joje MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Agar MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Angiotensin Converting Enzyme from rabbit lung (A6778 sigma) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Büret sporu MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Casein (casein from pancreatic) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Civa Sülfat (HgSO4) MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Ependorf Tüpü (1,5mL) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Et ektraktı MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Ethyl acetate MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Ferric citrate (228974) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Kolesterol (grade, ≥99%, C8667-500MG) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Kıskaç MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Laktik Asit Stripleri (25'lik) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Tülin ATAN 3623121919 BAP
MRS Broth (500 gr) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
MRS agar (500 g) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Maya ektraktı MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip amoxicillin*-clavulanic acid (2/1) -10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip ampicillin 0.016 - 256 amp-920031-10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip clindamycin (fda cleared) 0.016 - 256-10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip erythromycin 0.016 - 256-10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip gentamicin 0.016 - 256-10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip tetracycline 0.016 - 256 10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip tigecycline 0.016 - 256 10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mic test strip vancomycin (fda cleared) 0.016 - 256 10adet/kutu MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mikropipet Uç 20-200 µl MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Mikropipet Uç 5-100 µl MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
N-Hippuryl-His-Leu hydrate powder, ≥98% (HPLC) (H1635-25mg) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Nabız ölçüm saati, Polar FT YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Tülin ATAN 3623121919 BAP
PBS çözeltisi (Phosphate-buffer saline) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Pancreatin from porcine pancreas (P1625-100g) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Pepsin from porcine gastric mucosa (P6887 sigma 1g) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Peptone from casein (Tryptone) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Petri kabı (steril, plastik, 90 mm) (500 /pk) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Primerler (2 adet, ort. 21 baz) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Promega PCR master mix 500U MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
SEM görüntüleme analizi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
SEM-EDS analizi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Elif Hatice GÜRKAN 3623121919 BAP
TGA- analizi MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Elif Hatice GÜRKAN 3623121919 BAP
Temassız timpanik termometre (Vücut Isısı Ölçer) YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Tülin ATAN 3623121919 BAP
Vial (HPLC, için vida kapaklı, septumlu, amber) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Zymo DNA izolasyon kiti MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
partikül boyutu ölçüm analizi MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
1 Set C, Au/Pd kaplama DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Eda GÜLER 3623121919 BAP
Laktat Analizörü Laktat Scout YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Özgür BOSTANCI 3624577600 BAP
Laktat Scout Laktat Analizör Strip 72'lik YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Doç.Dr. Özgür BOSTANCI 3624577600 BAP
SEM Görüntüleme DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Eda GÜLER 3623121919 BAP
(R)-(-)-Carvone(R)-5-isopropenyl-2-methyl-2-cyclohexeno 100 ml ) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
2-Hydroxy-3-(Trifluoromethoxy)Benzaldehyde 1g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
2-Hydroxy-5-(trifluoromethoxy)benzaldehyde 500 mg FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
9-Formyl-8-hydroxy-1,1,7,7-tetramethyljulolidine (1g) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
DL-5-Hydroxylysine hydrochloride 100 mg FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
DLAB digital single chanel microliter 20-200 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Decylamine %95 25 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Dialysis tubing cellulose membrane avg. flat width 25 mm (1.0 in.) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Dialysis tubing closures blue, size 50 mm FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Ethylenediamine 100 ml 100 ML FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Hydrochloric acid %37 2,5 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Kuvars küvet spektrofotometre 300 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
L-Cysteine 100 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
L-Glutamic acid 100 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
L-Lysine 25 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Methanol anhydrous, 99.8% 2 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Palladium(II) acetate 1 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Petroleum eter 5 L FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Propylamine 500 ml -500ML FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Salicylaldehyde β-D-glucoside 1 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Single channel microlitre pipettes transferpettes, variable 20-200 mikrolitre FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
trans-4-Hydroxy-L-proline 5 g FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Ayşen ALAMAN AĞAR 3623121919 BAP
Absolü Etil Alkol FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Asetik Asit FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Beher 600ml'lik FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Boyama seti (10 lamlık sepet cam ve kapaklı boya kabı cam) FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Casein from bovine milk FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Entellan FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Erlen 500ml'lik FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Folın-Cıocalteu' S Phenol Reagant FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Glutathione Reductase FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Gıemsa' S Azur Eosin Solution FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Kalın uçlu pens 130mm FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Ksilen FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Kurutma kağıdı 40x40cm FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Lam, beyaz renkli, buzlu FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Lamel 24x32mm FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Linseed oil FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Metanol FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Mezür 100ml'lik FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Pens - diseksiyon - sivri/düz - 150 mm FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Preparat kutusu (100 lamlık) FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Vanderzant vitamin mixture FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Wheat germ Untreated FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Xanthine Oxidase FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
Yeast Brewers FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
hidroklorik asit (HCl) FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
kloroform FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
İnce uçlu pens 130mm FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üyesi Oğuzhan YANAR 3623121919 BAP
1,5 ml'lik mikrotüp FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1,5 ml'lik mikrotüp FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
2,2-Diphenyl-1-Picrylhydrazyl (Dpph) (5g) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Ayran Starter Kültür MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
DNA ekstraksiyon kiti (50 lik) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA ekstraksiyon kiti (50 lik) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Falcon Tüpü (50 ml lik) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
GEA PANDA PLUS 2000 O-RING 9531-4164-591 MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Harici kalp atışı düzenleyici (eksternal pace maker) özelliği olan bifazik defibrilatör* Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
Hekzan Hplc Saflığında (2.5l) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Kjeldahl Protein Analizi Katolizör Tableti 250 adet MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Kuru Kayısı MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Laktoz Tozu (Pharma Lactose) (Maybi) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Makro Küvet MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Mikro Küvet MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Mrs Agar Besiyeri (500 g) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Polyethılen Glıkol (1 kg) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Püskürtülerek Kurutulmuş Peynir Altı Suyu Tozu (Sweet Whey) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
TONER (HP 1005 İLE UYUMLU ORJİNAL 35A) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Andaç AKDEMIR 3623121919 BAP
Trabzon Hurması MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Transport ventilatör cihazı (erişkin ve pediatrik kullanımına uygun basınca[10-50 cmH2O] ayarlanabilir, PEEP valfli Sağlık Hizmetleri Meslek Yüksekokulu Dr.Öğr.Üyesi Faruk TAN 3624576089 BAP
ALPHA LIPOIC ACID 600 MG FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
GLUTATHIONE REDUCTASE FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
METHOTREXATE -50 mg/ml FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
NEOTIGASON(asitretin) 25 mg FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
RAT FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
SUPEROXIDE DISMUTASE FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Emine DIRAMAN 3623121919 BAP
1000 Adet fotokopi Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
52X 700MB 50li kutuda tekrar yazılabilir CD+R Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
64 GB USB FLASH BELLEK Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
80 gr. A4 Fotokopi Kağıdı(5'li Paket) Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
A4 Delikli Poşet Dosya( 100 Adet ) Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Bilgisayar yazıcı toneri Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Mavi tükenmez kalem Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
fotokopi Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Çıtçıtlı plastik dosya Sağlık Bilimleri Fakültesi Prof.Dr. Özen KULAKAÇ 3624576020 BAP
Human Irisin ELISA kit 96 test YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
ambu elektrot blue sensor YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
Elektronik Kağıt Kesme makinesi A3 52 lik REKTÖRLÜK KAYM52PD Doç.Dr. Onur BEKİROĞLU 3623121919 BAP
Geniş Format Yazıcı (Afiş Baskı Makinesi) (İç baskı) REKTÖRLÜK Doç.Dr. Onur BEKİROĞLU 3623121919 BAP
1000µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1000µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
10µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
10µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1kb DNA Ladder FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1kb DNA Ladder FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200 µl'lik PCR tüpü FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200 µl'lik PCR tüpü FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
96 well plate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
96 well plate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Agaroz (500 gr) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Agaroz (500 gr) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA TAQ Polimeraz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA TAQ Polimeraz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
dNTP mix FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
dNTP mix FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
3M Espe Filtek Ultimate Tek Tüp Nanokompozit DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
3M Espe Sof-Lex 240 lık Disk DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
96 Alkol (Merck) VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
Absolü alkol (Merk) VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
Dentsply Ceram X SphereTEC One DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
Dentsply PoGo Elmas Mikro Parlatıcı Refil DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
Enjektor 5ml'lik VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
Formaldehit (Merck) VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
GC Gradia Direct Kompozit Anterior DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
Grandio Flow DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Grandio Seal DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Oligonucleotideprimer 200 nmol VETERİNER FAKÜLTESİ Prof.Dr. Mehmet TÜTÜNCÜ 3121919122 BAP
Steril Cryo Tüp (dış vida kapaklı) (1 Torba = 100 adet) VETERİNER FAKÜLTESİ Prof.Dr. Abdurrahman AKSOY 3623121919 BAP
Tokuyama Estelite Asteria Estetik Kompozit DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Mustafa Erhan SARI 3623121919 BAP
Xylol (Merck) VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
İnsulin enjektörü VETERİNER FAKÜLTESİ Doç.Dr. Şerife TÜTÜNCÜ 3623121919 BAP
1,5 ml'lik mikrotüp FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1000µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1000µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
10µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
10µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1kb DNA Ladder FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
1kb DNA Ladder FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200 µl'lik PCR tüpü FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200 µl'lik PCR tüpü FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
200µl'lik Pipet ucu FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
96 well plate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
96 well plate FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Agaroz (500 gr) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Agaroz (500 gr) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA TAQ Polimeraz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA TAQ Polimeraz FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA ekstraksiyon kiti (50 lik) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
DNA ekstraksiyon kiti (50 lik) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Steril enjektör ucu filtre (50 adet) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
Steril enjektör ucu filtre (50 adet) FEN EDEBİYAT FAKÜLTESİ Doç.Dr. Haydar KARAKAYA 3623121919 BAP
dNTP mix FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
dNTP mix FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Aysun GÜMÜŞ 3623121919 BAP
Grandio Flow DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Grandio Seal DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Ertan ERTAŞ 3623121919 BAP
Absolü Etil Alkol 2,5lt FEN EDEBİYAT FAKÜLTESİ Dr.Öğr.Üy. Banu EREN 5334247112 BAP
SEM Analizi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
XRD Analizi MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Ayşe KULEYİN 3623121919 BAP
Human Irisin ELISA kit 96 test YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
ambu elektrot blue sensor YAŞAR DOĞU SPOR BİLİMLERİ FAKÜLTESİ Prof.Dr. Seydi Ahmet AĞAOĞLU 3623121919 BAP
1,4-Dioksan FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Aseton FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Dietileter FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Kloroform FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Kloroform FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Mağnetik Karıştırıcı (Balık, Muhtelif ebat) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
PH kağıdı (1-14 arası) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
Siklohekzan FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
hekzan FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
n-Bütanol FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
İzopropil alkol FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Hasan KOCAOKUTGEN 5359638903 BAP
50 bp size marker (50µl) TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
50 bp size marker (50µl) TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
Hizmet alımı TIP FAKÜLTESİ Prof.Dr. Ahmet Tevfik SÜNTER 3623121919 BAP
IPS E.MAX CAD B 40L A2 (3'LÜ PAKET) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Duygu SARAÇ 3121919368 BAP
IPS E.MAX CERAM DENTIN TOZ A2 100 GR. DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Duygu SARAÇ 3121919368 BAP
IPS E.MAX CRYSTALL CONNECT DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Duygu SARAÇ 3121919368 BAP
IPS E.MAX PRESS LT (5'Lİ KUTU) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Duygu SARAÇ 3121919368 BAP
IPS E.MAX ZIRCAD FOR INLAB MO B55 (3'LÜ PAKET) DİŞ HEKİMLİĞİ FAKÜLTESİ Prof.Dr. Duygu SARAÇ 3121919368 BAP
Kandan DNA izolasyon kiti TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
Kandan DNA İzolasyon Kiti TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
Loading dye (6x) , 5ml TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
Loading dye (6x) , 5ml TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
N-TERMİNAL TELOPEPTİT HUMAN ELISA KİT 96 TEST. SUNLONG SL0538HU DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Tuğrul KIRTILOĞLU 3623121919 BAP
OSTEOKALSİN HUMAN ELISA KİT 96 TEST. SUNLONG SL1308HU DİŞ HEKİMLİĞİ FAKÜLTESİ Doç.Dr. Tuğrul KIRTILOĞLU 3623121919 BAP
Pipet ucu - şeffaf - 10 ul - kutulu - steril (96adet/kutu) TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
Pipet ucu - şeffaf - 10 ul - kutulu - steril (96adet/kutu) TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
Pipet ucu - şeffaf - 1000 ul - kutulu - steril (96adet/kutu) TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
Pipet ucu - şeffaf - 1000 ul - kutulu- steril (96adet/kutu) TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
Pipet ucu - şeffaf - 200 ul - kutulu - steril (96adet/kutu) TIP FAKÜLTESİ Doç.Dr. Şengül TURAL 3623121919 BAP
Pipet ucu - şeffaf - 200 ul - kutulu - steril (96adet/kutu) TIP FAKÜLTESİ Prof.Dr. Nurten KARA 3623121919 BAP
Baskılı Roll-up REKTÖRLÜK ARES Doç.Dr. Onur BEKİROĞLU 3623121919 BAP
Canlı hayvan alımı ZİRAAT FAKÜLTESİ Prof.Dr. Mehmet Akif ÇAM 3623121919 BAP
Örümcek stand REKTÖRLÜK ARES Doç.Dr. Onur BEKİROĞLU 3623121919 BAP
1000 Adet fotokopi Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
100X50MM KADAR KABLO KANALI FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
18,5" 1366X768 5msl VGA FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
250 ml li balon joje MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
2XE5-2620v4 Nov ga 8c16 gb 1 TB W10PW7P FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
3X2,5 MM2 PVC ZOLE BESLEME KABLOSU FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
500 GB PCI M2 SSD 960 EVO NVME FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
52GWR-P 48 GE ports,4xSFP Web FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
600ml lik beher MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
64 GB USB Flash Bellek Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
A4 Kağıdı Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
ANAHTARLI OTOMATİK SİGORTA (10KA) 3X63A FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
ANAHTARLI OTOMATİK SİGORTA (6KA) 16A FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Ag2SO4 Gümüş sülfat (25 gr) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Amonyum hidroksit (NH4OH) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
BTS 424/16G16 GB SERVER MEMORY FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Beher 100ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Beher 25ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Beher 50ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Büyük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
CD-R Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
COD (KOİ) KüvetTesti Test/paket: 25 ÖlçümAralığı mg/l: 25 - 1500 COD (20Adet) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
CaCl2 MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
DATA PİRİZ CAT 6 RJ45 22,5X45 KANAL İÇİN FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
DEMONDAJ KABİNET FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
DVD Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Erlen 50ml MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Fenol MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
Filtre Kağıdı Grade 1 (2 adet) 70 mm MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Filtre Kağıdı Grade 2 (2 adet) 70 mm MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
HgSO4 Civa sülfat (100 gr) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Hortumlar silikon -- 6 mm iç çap -- 1 metre (5 adet) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
K2Cr2O7 Potasyum bikromat (250 gr) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
KAÇAK AKIM KORUMA ŞALTERİ 4X40(30MA) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
KabaFiltreKağıdı, 40x40 cm (2 paket) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Kalem Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Küçük boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Manyetik balık MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
Mikropipet Uç 100-1000 µl MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
MuayeneEldiveni, Latex (100 çift/kutu) 5 kutu MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
NVIDIA QUADRO 2 GB EKRAN KARTI FOR VS FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Orta boy klasör Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
PANO TİPİ AŞIRI GERİLİM KORUYUCU 230/400 15 KA FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
PLC Eğitim Seti - CPU 1214C (Y-0030-S3) MÜHENDİSLİK FAKÜLTESİ Dr.Öğr.Üyesi Erhan ERGÜN 3121919120 BAP
Piset, PE, Geniş Boyunlu Baskılı, Distile Su için, 500 ml (2 adet) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Poly(acrylicacidsodium salt) (100 gr) averageMw ~5,100 by GPC MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Polyvinylpyrrolidone (100 gr) averagemolwt 40,000 - PVP40 MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Sodium citrate dihydrate (W302600-1KG) MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Sodium tetraborate (221732 aldrich) 100g MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Sodyum Asetat MÜHENDİSLİK FAKÜLTESİ Arş.Gör.Dr. Nilgün ÖZDEMİR 3623121919 BAP
Sodyum aljinat MÜHENDİSLİK FAKÜLTESİ Doç.Dr. Feza GEYİKÇİ 3623121919 BAP
TOPRAKLI PİRİZ 16A 250V 45X45 KANAL İÇİN FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Telli Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
USB SET Q-TR KB72 KLV+OP620 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
UTP CAT6 HALOJEN FREE 4X2X23 FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
Vida Kapaklı PP Santrifüj Tüpü, 15 ml (50 adet/paket) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Feryal AKBAL 3623121919 BAP
Zero Client(VGA,RDP) FEN EDEBİYAT FAKÜLTESİ Prof.Dr. Vedat Suat ERTÜRK 3623121919 BAP
congo red (25g) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Semra ÇORUH 3623121919 BAP
k-carrageenan (Avrupa) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
starch of corn (Avrupa) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
ı-carrageenan (Avrupa) MÜHENDİSLİK FAKÜLTESİ Prof.Dr. Fehmi YAZICI 3623121919 BAP
Şeffaf Dosya Sağlık Bilimleri Fakültesi Doç.Dr. Zeliha KOÇ 3624576020 BAP
Analitik terazi ZİRAAT FAKÜLTESİ RADWAG AS 220 R2 Prof.Dr. Ümit SERDAR 3623121919 BAP
Isıtıcılı karıştırıcı ZİRAAT FAKÜLTESİ MTOP MS 300 HS Prof.Dr. Ümit SERDAR 3623121919 BAP
0,1-10 ul Pipet Ucu (1000 lik poşet) ZİRAAT FAKÜLTESİ isolab Doç.Dr. Musa KAVAS 3623121919 BAP
0,2 ml PCR tüpü (DNAse ve RNAse free) (1000 ad/pk) ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
0,5-10 ul lik pipet ucu (1000 adet/poşet) ZİRAAT FAKÜLTESİ İSOLAB Dr.Öğr.Üyesi Aslıhan KURT KIZILDOĞAN 3623121919 BAP
40x40 cm yaprak filtre kağıdı (her kutuda 200adet) ZİRAAT FAKÜLTESİ Doç.Dr. Musa KAVAS 3623121919 BAP
AarI restriksiyon enzimi (125 unit) ZİRAAT FAKÜLTESİ thermo fisher Doç.Dr. Musa KAVAS 3623121919 BAP